sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - 2240 nt intron 10 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.14307
gtgagtgccttgtgcccccgtgcccacttaggtaggggtggagcctggctggactggatt  c.1606+60

         .         .         .         .         .         .  g.14367
caggaggatagggatgccatggaaggtgagtgccctgtgccccctctacccattcaggcc  c.1606+120

         .         .         .         .         .         .  g.14427
cctgaggtcagggtggggcctggctggaccagcttcaggacagtaacttaatattggcat  c.1606+180

         .         .         .         .         .         .  g.14487
agaagaaatggctatatttatactatatttatcacagccatttctggctgtcacaaatat  c.1606+240

         .         .         .         .         .         .  g.14547
agtcctgtcttaacctggcccagttctagctgcaaggccaggctgctatgggaactgggg  c.1606+300

         .         .         .         .         .         .  g.14607
gcttccgggagggccttggggactgcccaatgggaagcacaggctaataatactaaccag  c.1606+360

         .         .         .         .         .         .  g.14667
aaggcccaatgttccggaaactggacatcctgctcctcaagtgttctctgggtaaaagtt  c.1606+420

         .         .         .         .         .         .  g.14727
aaaggccaaaagtcaaattctgcccaaacagagtgacagactccccaatccctgtgccac  c.1606+480

         .         .         .         .         .         .  g.14787
atgctgaatctcagaagaataaggatgtcatgatgagagagggtgaatagacacgacacg  c.1606+540

         .         .         .         .         .         .  g.14847
acagatggatggacagatggatggacggacggatggatggatggatggatggatgagagg  c.1606+600

         .         .         .         .         .         .  g.14907
gagggaagtagggaggcaggagggaaggaggaagcacaggaaaaagggacaatagagaaa  c.1606+660

         .         .         .         .         .         .  g.14967
aggaattctgacacacagagatgtggttccctccccaggtcggcttgccttgtgccaggg  c.1606+720

         .         .         .         .         .         .  g.15027
agttgggggccctgcaggactttgcagatctctagaggtcaccatgtcacctgaccttgt  c.1606+780

         .         .         .         .         .         .  g.15087
atgacaggtatccaggtgcccatatgccctgccagagggtacccagggaatgctggggga  c.1606+840

         .         .         .         .         .         .  g.15147
ggaggcctctccaccctgccgttcctgggaccactgtgagaagttttgggcctcagacac  c.1606+900

         .         .         .         .         .         .  g.15207
tgtttgggcacctgcagaagcacagggtaggggtggaggtgcagactggggaggctttga  c.1606+960

         .         .         .         .         .         .  g.15267
gtgacactcagtgtgctaattactgggtgtgggagggaggttcagccaccctccccggca  c.1606+1020

         .         .         .         .         .         .  g.15327
tgaatccagggtctccatggggctgccacccactccagtcccttttctttgtctttgaaa  c.1606+1080

         .         .         .         .  g.15367
tgggagccactgattgtatttaccgggaggcactgattgt  c.1606+1120

--------------------- middle of intron ---------------------
       g.15368      .         .         .         .           g.15407
       c.1607-1120  atttacctgctgtgatgagtaagtgagatcgtgcctgggc  c.1607-1081

.         .         .         .         .         .           g.15467
caaggacactccgaatgtgtccccaccgtgccccatatttccacacagccaaacagccca  c.1607-1021

.         .         .         .         .         .           g.15527
ccaaggccaggaggaggaggaacagctttgtcccacggtccttacaaagcactcgtggct  c.1607-961

.         .         .         .         .         .           g.15587
ttggggtggcaagaacaggggatgtttcttgaaggccactgtggtgggaaaggatggacc  c.1607-901

.         .         .         .         .         .           g.15647
ggctggggacactttggaggggccggtattaccgacagtgcatccccgagggatctgtct  c.1607-841

.         .         .         .         .         .           g.15707
gtgcagagttgcactagccagcagctcatggggctggaacccaagcccctgcagtggcct  c.1607-781

.         .         .         .         .         .           g.15767
cccgcctctccctgggaactcggacccagacagattagggcatctcacaggccaggctcg  c.1607-721

.         .         .         .         .         .           g.15827
cagccctgggcctctggcagggggtgggcgtcctgtccagctccctgaggggtggggctt  c.1607-661

.         .         .         .         .         .           g.15887
tgtggggtgagtcaagagggcggggcttgaggcagggcattgaaaggcggggcttgggga  c.1607-601

.         .         .         .         .         .           g.15947
aaagtttgctgaggaggtggtcctgtgagttactgcactaaggggcggagcttcgggagg  c.1607-541

.         .         .         .         .         .           g.16007
aggcggggcttcctcaggagttgggaatgtgggcggggtttagaggggacggacatgagg  c.1607-481

.         .         .         .         .         .           g.16067
atgcgctctgtgaggcggaggagcttggagccgggggtggggctttgaggaggtggggct  c.1607-421

.         .         .         .         .         .           g.16127
ttgaggggcggggttgtgggcggggtttagagaggtgtgtccggagggtgatgcggtgag  c.1607-361

.         .         .         .         .         .           g.16187
tggtggtggaacttgaagtagagggcggagcgctgaggacgcgggggttccaggggtggg  c.1607-301

.         .         .         .         .         .           g.16247
gctgtaggcgggggttagagggcgggatctggagggtgctcactgaggcggtggagcttg  c.1607-241

.         .         .         .         .         .           g.16307
gagccggccgcgctcagagcgcggggctttggggtgaagccatgtggggcggaggttaca  c.1607-181

.         .         .         .         .         .           g.16367
ggggaggtgacagtaagggtgacgcaagaggcggtggaacttggaataggccttgctaga  c.1607-121

.         .         .         .         .         .           g.16427
gggttgagatgtggagtgctaaggggcggggcttggaaggtggaacaaaagctctagctg  c.1607-61

.         .         .         .         .         .           g.16487
gagccgggggcacgtgaggggataatcctcaccagatacctgctaccacccctctcccag  c.1607-1


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center