sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - 1754 nt intron 11 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.16786
gtagggaggggcgggggaggggatcattcatgggcaggatgggagggggtagggcccagt  c.1845+60

         .         .         .         .         .         .  g.16846
ggagctgtctggctgtatgtaaatatagggcacggtgggggacacatgcggacagctggg  c.1845+120

         .         .         .         .         .         .  g.16906
gttattttcccagcatatgggaggcatgagttgatgtgggggggggtacttggggtgatc  c.1845+180

         .         .         .         .         .         .  g.16966
tgtggcacacagaactggggtttcaggacatttaggggcagggagatggggttgaggcgc  c.1845+240

         .         .         .         .         .         .  g.17026
tgggcttcctaaggtccagattcttggggatctgggatccagaccatgccctggaagcag  c.1845+300

         .         .         .         .         .         .  g.17086
gggtgaggaaatgggggtgtggagataggggtgaaggggctagctgacaagtctgtccac  c.1845+360

         .         .         .         .         .         .  g.17146
ttccagaagttgtcatgggcctgaaaggagccaagggatctggcagtgtgacctatagcc  c.1845+420

         .         .         .         .         .         .  g.17206
ctggctacccaggaccagtgggctgcaggggttactcccccaaccctcacctatttctcc  c.1845+480

         .         .         .         .         .         .  g.17266
agcgtggccaggcttctcctctctccagccctttcctgctccactattgttgacaccact  c.1845+540

         .         .         .         .         .         .  g.17326
gatccgcccgcttatccaggcccattaggagcattatcacctcattgccggccccagagg  c.1845+600

         .         .         .         .         .         .  g.17386
agcctgacaaagggaaaagccgcctcctcctccagccctgccccacccttcccaattccc  c.1845+660

         .         .         .         .         .         .  g.17446
tttgcaatttttccaggacggcaaatgggcgagatgctccccaaccctgaaggttagggg  c.1845+720

         .         .         .         .         .         .  g.17506
aagccagggagagtaagatttggggtctgggagagaaccagggctgggtgggtggcacga  c.1845+780

         .         .         .         .         .         .  g.17566
gaatcaaaccctgggctccccagccttcgaggcaggcacgtctgtcctatagaggtgccg  c.1845+840

         .         .         .         g.17603
aggcagccatggccaggctgggctggaagggtaaggg  c.1845+877

--------------------- middle of intron ---------------------
           g.17604            .         .         .           g.17640
           c.1846-877  cgtgctctggactcgtggcacagctgctgggatgtgc  c.1846-841

.         .         .         .         .         .           g.17700
gtgatggaccgggcctgcccgcttgcccaccccctgcccacactatgctgctgccttggc  c.1846-781

.         .         .         .         .         .           g.17760
acctgctgtggccagggacagcctctgggaggggctcagcatgtgcccaggcaggctgtg  c.1846-721

.         .         .         .         .         .           g.17820
gacccagggcagctggtgcctggcaggaggggggccgtgcccagggagctttcagggact  c.1846-661

.         .         .         .         .         .           g.17880
gtgcaatcctcagatcccatgtccagggttggcaggggaagctctggtcttcttctcact  c.1846-601

.         .         .         .         .         .           g.17940
gattttgctccttttggtccctgccctaaacctttgagtctgccaagatttgcaagatcc  c.1846-541

.         .         .         .         .         .           g.18000
tgggagtggtccctgtggagaggctgtaggcatacagacaggatgctgaactgagcacct  c.1846-481

.         .         .         .         .         .           g.18060
gagaactgggcttgagatgtggctcgttcccatgtgggtgctgtgatgccagctagctgc  c.1846-421

.         .         .         .         .         .           g.18120
ccagctagctgagcctcaactgctcatgtgtggaatgcatgtgagaatccctcccaacat  c.1846-361

.         .         .         .         .         .           g.18180
tgtagagatcaggataccagtgaagtcacaaagtgaaccacagagcgccctgcaaatgtt  c.1846-301

.         .         .         .         .         .           g.18240
gaatattatgacagggttgggtctccaaggagtgaagtgccttgcccactgtcacaaggc  c.1846-241

.         .         .         .         .         .           g.18300
cagaaatgaatgggaacgggtctcagagttgtacccacctaggccctatgacttggcctt  c.1846-181

.         .         .         .         .         .           g.18360
tgcctccatcactcacttatacacacacgggccatgcatgccactcctgctcctctcagg  c.1846-121

.         .         .         .         .         .           g.18420
gctctggaccccttcccctccgcccccgcagcctctgccaggaggtgggagttgggtggg  c.1846-61

.         .         .         .         .         .           g.18480
agacttccagggccctgggctccccgaggctctgtgacagggcctcatgccaccccctag  c.1846-1


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center