sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - 1895 nt intron 14 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.26555
gtgagccggggctggggctcagacagacccggcttcaaattctcctgtgacctggagcaa  c.2853+60

         .         .         .         .         .         .  g.26615
gccctaagtcctctctgagcctcagtttctccagctgtaaaatgggggtggtgccctatg  c.2853+120

         .         .         .         .         .         .  g.26675
gcattgttgcaagcattatgtgagacgctgtatgtaaagcatgcagtccgcgccctgtga  c.2853+180

         .         .         .         .         .         .  g.26735
gtggtggcagtcactatcgttattgatgtggttattatgatcaaccctgtctgtccagaa  c.2853+240

         .         .         .         .         .         .  g.26795
accctgattccctcggaccagaacacctgggcccctctcaccagcaggtggtgcccttgg  c.2853+300

         .         .         .         .         .         .  g.26855
acatgctgcttttacctgggcaccgcagctccaggaccaggacctgagaggcctctctta  c.2853+360

         .         .         .         .         .         .  g.26915
catattctcctctgggtttgaggccccttgcccagtcctcacacttatcctctatctctg  c.2853+420

         .         .         .         .         .         .  g.26975
tttagaccccacctgggtctgctcccaacctcccagtgtgggccaaagtgccagatccag  c.2853+480

         .         .         .         .         .         .  g.27035
gcaggggattcaggagaggagctaggggccaacgggagttgaggacaaggaggacagaag  c.2853+540

         .         .         .         .         .         .  g.27095
cctcaggcaggagccctgacccctcagccatgcagggggtgtgctgctgggctcagatgc  c.2853+600

         .         .         .         .         .         .  g.27155
ccctccccacccctccactgcgaggtcgaggaagggacaggaacgcagcggtggtaaccc  c.2853+660

         .         .         .         .         .         .  g.27215
ccagcagctgaggctgaggctgaggctgaccctgcctgggtcttgagcccccttccccac  c.2853+720

         .         .         .         .         .         .  g.27275
tgtccagctctggcagggaaaggactcatacaggagctaggacgagggcccctgcccacc  c.2853+780

         .         .         .         .         .         .  g.27335
cctgcaccatcagcctgagcctaatgaactttgccctgaaagcttttgactccttattcc  c.2853+840

         .         .         .         .         .         .  g.27395
ccccaaatatgctggcttaccaggaagcgagtgcctgtgagctataaatacccaggcaac  c.2853+900

         .         .         .         .          g.27443
tgtggcacagacctcggtatgaggcactcaggtggcgggggagctgga  c.2853+948

--------------------- middle of intron ---------------------
 g.27444            .         .         .         .           g.27490
 c.2854-947  gagcaccaaagtcccaggctccccggggccggggccggggcctgggg  c.2854-901

.         .         .         .         .         .           g.27550
acttgttcaaggagggcgagcacaactccaagggagatttagggagttgagtgcacaatc  c.2854-841

.         .         .         .         .         .           g.27610
ggggcaagcaactcagtggatgccctggctgacctaacactctgtgcctcagtttccctt  c.2854-781

.         .         .         .         .         .           g.27670
ttagtctaatgaaaacaaggacccccaccccggccatggtggttttctggtcaccactct  c.2854-721

.         .         .         .         .         .           g.27730
ggatacagagctgccccccaagttgccctcttcttccttctcttcagaggcctcaccctc  c.2854-661

.         .         .         .         .         .           g.27790
agccttgaaggggtcccctgccgggtggagtctggggccgggaagctggcctggcccagc  c.2854-601

.         .         .         .         .         .           g.27850
aggaggaggtgggaggaagcctggcccggctggagcacccgcctcccccactcccgctcc  c.2854-541

.         .         .         .         .         .           g.27910
caacactgatcaggttcccttggcactggatggaggctttggctggggaacattttccac  c.2854-481

.         .         .         .         .         .           g.27970
cctttctggattcctcagccaaacagaccctgcgggtgggaaggctcagacgctaggggc  c.2854-421

.         .         .         .         .         .           g.28030
accacacgcccatgttctgagggctgtgatagcctggctccatcctgaccccttttcata  c.2854-361

.         .         .         .         .         .           g.28090
cccctgccccctcagagctaccttcaggccccccatgcctcccagaccccccactcgggc  c.2854-301

.         .         .         .         .         .           g.28150
cggggtccccgcctcctcccttatctgaggccttcgcatgtgtcctcatgcccttaccgt  c.2854-241

.         .         .         .         .         .           g.28210
cccttcccaggcatcagccccgccccactccttatataagtgtcatgcgggcatgaccag  c.2854-181

.         .         .         .         .         .           g.28270
ggccacctacgtccccgtggttcctcgaccatccagggctggatgaatgaatgaatggat  c.2854-121

.         .         .         .         .         .           g.28330
gagtttgctcctccctctcttcttcccttcccttctggtctcccatcctgccccatctgg  c.2854-61

.         .         .         .         .         .           g.28390
taggaggatgagggggtctctcagggacccagatgtcatgtgaccctgtggcctccgcag  c.2854-1


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center