sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - 547 nt intron 16 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.29368
gtaggcactgcctgggagcacgggtcaggggcaggggccaggcccacagcaggtcctctt  c.3144+60

         .         .         .         .         .         .  g.29428
ggggctccctgtctccacacacaggaagggccatgctctggtcagtcccaaaccctgaga  c.3144+120

         .         .         .         .         .         .  g.29488
atcctaaaggaactcgctgtgcctccgggataggttataggatgtgctgactttctaaca  c.3144+180

         .         .         .         .         .         .  g.29548
tggcagaggtgcctcccttattacgtgggtgctgacttttgtgcactctctgctgataag  c.3144+240

         .         .         .      g.29582
gaggcaggagacccctgggaactgggggcgcagg  c.3144+274

--------------------- middle of intron ---------------------
               g.29583        .         .         .           g.29615
               c.3145-273  actgaagatgtgtcactgtggacctgcccagca  c.3145-241

.         .         .         .         .         .           g.29675
gatgatggcaatttgctgttgttgggcttggagaaggggggctgagggattctccccact  c.3145-181

.         .         .         .         .         .           g.29735
gggaaacgctctcatccccatgatgggtggtgggagtccaggagatgcggacagcctgtc  c.3145-121

.         .         .         .         .         .           g.29795
ccttgggctgggcccccacggcagacccccgggaaccagcagcatagagcagggcagggg  c.3145-61

.         .         .         .         .         .           g.29855
acctggctgccaccccagcctgctggaccccagccaccctggtggtgctggtgcccccag  c.3145-1


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center