sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - 722 nt intron 17 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.30089
gtgagtccccccacgctggccccgtagctacatccagaggctgtcagtgtggcggggacc  c.3318+60

         .         .         .         .         .         .  g.30149
tcaggaagcccacgccctgaagggcaggacctgcccgaggccacccccagagtcagaccc  c.3318+120

         .         .         .         .         .         .  g.30209
tcaatcagtgctgcccttctcagacagagctgcccagggaggggttagggactgggaggc  c.3318+180

         .         .         .         .         .         .  g.30269
cttcccttctcctcagggaaaggaggccttgggggaagacagcaggcaggagggctactt  c.3318+240

         .         .         .         .         .         .  g.30329
accatccctgccaataggagtggaggagtttcttacttcatacattttatttatttattt  c.3318+300

         .         .         .         .         .         .  g.30389
ttaagatgggatcttgctatgttgcccaggctggtcttgaactcctgggctcaagcaatc  c.3318+360

   g.30390
c  c.3318+361

--------------------- middle of intron ---------------------
                                               g.30391        g.30391
                                               c.3319-361  t  c.3319-361

.         .         .         .         .         .           g.30451
cctaccttggcctcccaaagtgctgggattacaggtgtgagccaccatgcccggccagga  c.3319-301

.         .         .         .         .         .           g.30511
atggaggattttcttagcctcttagatgggctcacaggcctccccgaaggagtcgggtac  c.3319-241

.         .         .         .         .         .           g.30571
catccctcctactcacagtcatccccagttggttgatgacatcactgaggtggtgccagg  c.3319-181

.         .         .         .         .         .           g.30631
ctcctacaggtactgggacaggtcccagggctgctcttcccaccggacaggaccacccac  c.3319-121

.         .         .         .         .         .           g.30691
tagggaggggatctaagggagacaaccaggagctgtgagtccaggaagacccccgtggcc  c.3319-61

.         .         .         .         .         .           g.30751
tgggcttgaggggaggctgggggccttgcacgcactgatcccctcacccctcccctgcag  c.3319-1


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center