sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - 1406 nt intron 18 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.30934
gtgggtgctgaaggggcctctggggtgggctggggatgggggaccggccaccttcactgc  c.3441+60

         .         .         .         .         .         .  g.30994
agggtggagggtgcatgtctatactccaaccaccaccagagggaagcagagagcttggac  c.3441+120

         .         .         .         .         .         .  g.31054
ccacggccctgcctgaggccaggtctggcccccacctcccctagctgtcctccccgcagg  c.3441+180

         .         .         .         .         .         .  g.31114
ccatcttctgcctgccccattcccactctcagcccccgatccagcccgcccttagcttac  c.3441+240

         .         .         .         .         .         .  g.31174
ctctgccactacttgaggggagcagagactgcagaagcacccaggagggccccacggcca  c.3441+300

         .         .         .         .         .         .  g.31234
gggaagaggaggaaggaaggcaggtttatgtggtgtttatgggtggtttatgagtgggtt  c.3441+360

         .         .         .         .         .         .  g.31294
tatgggtggccctccccagcctcagactgagccacccagggctttgaaacaaggtgcctg  c.3441+420

         .         .         .         .         .         .  g.31354
caccctggctctgagccttcccctcaccccccactgatgagcttggcgtcacggttgggg  c.3441+480

         .         .         .         .         .         .  g.31414
ccatgcccttgagcttggggtcagtttggggaagatccactcaggccctggagagcggaa  c.3441+540

         .         .         .         .         .         .  g.31474
gtggcaggtaaacacagggttgcggcggggtgggggggggggcaagaaaaatgggacttc  c.3441+600

         .         .         .         .         .         .  g.31534
cccaggaagagagatctgctgggagcaagacctgctccagcgggacaaatttctgcaaat  c.3441+660

         .         .         .         .     g.31577
ctagaggccatggcgagcccccccaagcggccccttcctgtcc  c.3441+703

--------------------- middle of intron ---------------------
     g.31578        .         .         .         .           g.31620
     c.3442-703  ctgcaagaggccagccgaatgctgggccctctgaccccccaga  c.3442-661

.         .         .         .         .         .           g.31680
gccagggagccctcccgttgaggggaaacaagctgcctgtggccatgcagctggtcagtg  c.3442-601

.         .         .         .         .         .           g.31740
ccccaaccaggaacagagctcccctgggcacaccaggcttgtgccacccactctagaggt  c.3442-541

.         .         .         .         .         .           g.31800
catgaaatggctcctccttaaaaagagaggggtgtcagatccagcccagtctgcagtggt  c.3442-481

.         .         .         .         .         .           g.31860
caggtgggctgtgtgactagggctggtggggatggggcttctgtcccagagctcctgctg  c.3442-421

.         .         .         .         .         .           g.31920
cttcaaagaccctggtgccctcttttctgtgcctgtgtctggggctctggggctgaaaac  c.3442-361

.         .         .         .         .         .           g.31980
ccatgagcaggggctgggtcacgtgagctgagtttcctatgggggctgagcaaagagtgt  c.3442-301

.         .         .         .         .         .           g.32040
ttgtctcctgcctggtgacctgtgaccaggctgcttccagagaaacccagcacccctact  c.3442-241

.         .         .         .         .         .           g.32100
ctgggctgatggctccagtcaagcagagagccctcttgaccaccaggcctgcagctccct  c.3442-181

.         .         .         .         .         .           g.32160
ccccctcccccttaccacccccaacctgcacacacacagcccagcaggtcggccctcctc  c.3442-121

.         .         .         .         .         .           g.32220
taggaagccctccctaattgacaatgcccagctctgcctggtcccctgggtggcgtagag  c.3442-61

.         .         .         .         .         .           g.32280
atgtggagccctctctcagaggctgggagaggcactggcaatggaccccctggcccccag  c.3442-1


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center