sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - 299 nt intron 19 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.32619
gtgagtgtgacccaccacccctgccgggaacctggatggaggtgccccccaccccggtcc  c.3720+60

         .         .         .         .         .         .  g.32679
tctcgttgtacccaaccccagtgtcactcctggttaggggaccgcccaccctgcttccaa  c.3720+120

         .         .         .  g.32709
tgctgtgggatccccaggcagtgtctagac  c.3720+150

--------------------- middle of intron ---------------------
                   g.32710              .         .           g.32738
                   c.3721-149  ctctctggtctttatttgatgctagccca  c.3721-121

.         .         .         .         .         .           g.32798
gtggggctctggcaggcggcctctggcaggggaggaccaggttgggtgggggagggaaac  c.3721-61

.         .         .         .         .         .           g.32858
tcatggatgatgaaagcagggagcagccccccggctcactccccaaccacactctctcag  c.3721-1


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center