sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - 196 nt intron 20 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.32972
gtgagtcggggtcgctgagatgtggctggtgagcgagccagggaagaggactcaagacag  c.3774+60

         .         .         .          g.33010
gagggagacttggcagcacgttctgtccccgagacttg  c.3774+98

--------------------- middle of intron ---------------------
           g.33011            .         .         .           g.33048
           c.3775-98  gcagccctgggggtggatgggtcctgccctcagggctg  c.3775-61

.         .         .         .         .         .           g.33108
tggggggcagggagaagccagcgtgcaaacccacgccgtcccaccctgtggctcccacag  c.3775-1


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center