sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - 822 nt intron 21 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.33306
atgagtatcagcccagcccctcgggccctcccggtgctgggcctccctcctgcctccttt  c.3912+60

         .         .         .         .         .         .  g.33366
gtccactctccattgcacaaacccacaaacgctgcctgagcacctaccaggttgttggtt  c.3912+120

         .         .         .         .         .         .  g.33426
caggcagctagcttgggtcccagtcccaccaggccaccttgaacaagtggcttggcctcc  c.3912+180

         .         .         .         .         .         .  g.33486
atgaacctcggtgtccttatctgtaaaatgagactgctgggccaggcacggtggctcatg  c.3912+240

         .         .         .         .         .         .  g.33546
cttgtaatcccagcactttgggaggccgaggcgggcggatcacaaggtcaggagttcgag  c.3912+300

         .         .         .         .         .         .  g.33606
accaccctggctaacgtggtaaaaccctgtctatactaaaaatacaaaaaaaattaaaaa  c.3912+360

         .         .         .         .         .   g.33657
aagaaattagccaggcgtggtggcaggcatctgtaatcccagctactcagg  c.3912+411

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.33708
         aggctgaggcaggagaatcgcttaaacccaggagatggaggttgcagtggg  c.3913-361

.         .         .         .         .         .           g.33768
ccaagatcgcgccactgcactccagcctggtgacagagcgagactccatctcaacaacaa  c.3913-301

.         .         .         .         .         .           g.33828
aaaaaaagacgaggctgctacaacctgccttgtgggttactctagggctcagcgagatgt  c.3913-241

.         .         .         .         .         .           g.33888
tgatgaaaagtagccagaaacaggctgcaagacagcattgatccccactccccttccctc  c.3913-181

.         .         .         .         .         .           g.33948
ccttctcctcggtcccgcattctccccttgtccctccatctctgaccctcccgcttcctc  c.3913-121

.         .         .         .         .         .           g.34008
caggctgatcaacaggggcgggggctgccttaaaggtgaggtgccccactgaggtggggg  c.3913-61

.         .         .         .         .         .           g.34068
tggtcctggaggcaggaaggggaactgcacctcaacctgacaagccctatcccactatac  c.3913-1


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center