sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - 649 nt intron 22 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.34233
gtacagacctctgggccccctgtcctgtgtgtgctgccaggctcctgcctaggggactga  c.4017+60

         .         .         .         .         .         .  g.34293
tgggggtaaaaggtttcctgccttccacccaccaggctgtgtccctgggtgaggttaggc  c.4017+120

         .         .         .         .         .         .  g.34353
ccaccccaggggcaggggacttggtctacctgcagggagggacgcctctttgtagtgcca  c.4017+180

         .         .         .         .         .         .  g.34413
cagagacaccatatgcacagaggctgtccatgaaactctagtgagtgctttaccctcact  c.4017+240

         .         .         .         .         .         .  g.34473
tggtcccacgaagctcctcagtgcccacctacctcccacctgggaccccagtggcccctg  c.4017+300

         .         .       g.34498
gggcaagggctcccacaagtggaag  c.4017+325

--------------------- middle of intron ---------------------
                        g.34499         .         .           g.34522
                        c.4018-324  gaggaggatgtccagacaccctac  c.4018-301

.         .         .         .         .         .           g.34582
ccaggagcaatgactttggaagaaaggggaggagcatctgggggatcttgaagggaggac  c.4018-241

.         .         .         .         .         .           g.34642
catgaaccccataaaatgacctggtcccagacctgtcatgatctgatgggtcacccctcc  c.4018-181

.         .         .         .         .         .           g.34702
tcccctggctgactccaccacaacccccaacacctcctttctctctctctctctctctct  c.4018-121

.         .         .         .         .         .           g.34762
ctctgtcatctctgtcatctctgtcatgctgtggtgccatcctgtgcctcctgcctgtcc  c.4018-61

.         .         .         .         .         .           g.34822
atgtcctgtctgggcctggccaccccaactcctccacatccactcccacccatgctgcag  c.4018-1


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center