sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - 832 nt intron 23 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.35153
gtgagcggggcgggctggaccggcagggcagcactgagctgaggcactcgggaagaccca  c.4288+60

         .         .         .         .         .         .  g.35213
tcctcacacggacacacctgcccctgcaccctcacacgctcacccagacacatgcctgtg  c.4288+120

         .         .         .         .         .         .  g.35273
cgtgcctgccattcactctcaatgcacaaaggcacatggtgtgcacacaggcagatcgtc  c.4288+180

         .         .         .         .         .         .  g.35333
acccgcgcacacatggatgcacctcaggacacacaactgaccagaagacgtgcactcagg  c.4288+240

         .         .         .         .         .         .  g.35393
tgcccacatactgagcgaaaagtgtaaaagatggttccatgtctgtgtgcactgagaagt  c.4288+300

         .         .         .         .         .         .  g.35453
gcacagtcatgcgtgtgcttatgatagaaagtagctgccatttattatcaactgtgctgt  c.4288+360

         .         .         .         .         .        g.35509
gcgcttgacaggtgttatctcacctgttgttcataacaatgtcatgatcaggaact  c.4288+416

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.35565
    gttgttcccattttacaggtaaggaaattgaggcacaaacaagtgaagtggagacc  c.4289-361

.         .         .         .         .         .           g.35625
cagagtcacgcagctgttctgtctccctctctctctgtctctctctctctgtctctttca  c.4289-301

.         .         .         .         .         .           g.35685
cacacacacacacacacacacacacacacacacaccagtggcatttgcaaacagccttgg  c.4289-241

.         .         .         .         .         .           g.35745
gaatgggccttacactcccccacttcagggtatcccacctccagttccatcaagacaaag  c.4289-181

.         .         .         .         .         .           g.35805
ctgcagcccctggccccaagacccgtgggagagcccagcctcacctgtcagtcatctggg  c.4289-121

.         .         .         .         .         .           g.35865
ctgtgctctgagacttgagcagagcacaccaggccgggccccctgagccccgcatgctcc  c.4289-61

.         .         .         .         .         .           g.35925
ccacaccctgtgccggcccccctccccagtggcagcgtcctcactagcttctccccgcag  c.4289-1


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center