sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - upstream reference sequence


               g.1            .         .         .             g.37
               c.-5077 cggagggtgtgtgtgcaaaagcagatagcaggaaaca    c.-5041

.         .         .         .         .         .             g.97
ggctattgtaagagactattgtggtatggacccagggagatggaaaaatgtcaaatatag    c.-4981

.         .         .         .         .         .             g.157
gagtatgtgggagatgatattaatagaactttggacaggcttggtgtggaaggtgaagaa    c.-4921

.         .         .         .         .         .             g.217
aaaggagaattcagggagataccttaattttttatttgagcagccaatagcagtgatgcc    c.-4861

.         .         .         .         .         .             g.277
gtttcctgggttgaagggtggaacagtggaagatgcaaacgtctgattgcagttgggagg    c.-4801

.         .         .         .         .         .             g.337
gtgtgagccatcccggtggagccgtctgggggcagttgaatataccagcctggacgtcaa    c.-4741

.         .         .         .         .         .             g.397
gggaaacgtttatcacattcccatgacattactattattttattcatgaacttattattt    c.-4681

.         .         .         .         .         .             g.457
tataattaatttattattttattgtatttattgatttttagagacacggtcttgctctat    c.-4621

.         .         .         .         .         .             g.517
cgccgaggctgtagtgcagtagtgcaatcacagctcactgcagactccacttccgtgggt    c.-4561

.         .         .         .         .         .             g.577
tcaagtgatcctcctgcctcagcctcccgaatagctgggactataggcacacaccaccgc    c.-4501

.         .         .         .         .         .             g.637
acccagctaattattttgttttttgtggagacagggtctcactatgttgcccagactggt    c.-4441

.         .         .         .         .         .             g.697
ctccaattcctaggctcaaacgatcctcccactttggccttccaaagcactgggattaca    c.-4381

.         .         .         .         .         .             g.757
ggcgtgagccaccgtgcctggccccatgacattatttatggtcataggaatgatgccacc    c.-4321

.         .         .         .         .         .             g.817
ctgaaccagctcgaaccctgaaaaacattagagattggggacagaaatcaggacaagcag    c.-4261

.         .         .         .         .         .             g.877
aggaaagtgatacggagcagccagggatgtggaagggaaacagcaagcagcttccatgga    c.-4201

.         .         .         .         .         .             g.937
ggctgtgagaatcaggtgcttccagaaaggggctgtggccaactgggctgcatgcttctg    c.-4141

.         .         .         .         .         .             g.997
agaggctctgggagctgaggacagaagcgtgttcactggacttggcagcagggagggtgt    c.-4081

.         .         .         .         .         .             g.1057
tagtgacttgacaaaagtagtttcagttgaaggggaaacggaagccaggttggaatggat    c.-4021

.         .         .         .         .         .             g.1117
tggagagagaatgaaaggtaaggaagtcaagacagctggtgtagacactttccaagaagt    c.-3961

.         .         .         .         .         .             g.1177
tttactgtgaagaggaaagaaaaatagggcaatagatgcagggaggtgtggggccaggag    c.-3901

.         .         .         .         .         .             g.1237
aatagttttgtcaccactgccattgtttttaaagtgggggacactagagtctgttcacag    c.-3841

.         .         .         .         .         .             g.1297
atggggagaggtggatgggcagtagagagagggcacctggagaggtctttgagaagcaag    c.-3781

.         .         .         .         .         .             g.1357
aggggctggggtcctgagccccaggaaagcctgacccttgcttcttattattattctaac    c.-3721

.         .         .         .         .         .             g.1417
aggatagaggaagacggggtgggatggggagatggttctgtggatttgacagtgtgtgtg    c.-3661

.         .         .         .         .         .             g.1477
tagtggttcttccttcctcagggaagaccatcagctgggaggctcatggggaggagcgcg    c.-3601

.         .         .         .         .         .             g.1537
gaggtctgaggaaagaggagaaggcatgaaatagttgttttcaaaaagtggaaaagtgag    c.-3541

.         .         .         .         .         .             g.1597
cctaccagaaaaatccacactacagggctggcaggattgaggacaaacccagaatatgtg    c.-3481

.         .         .         .         .         .             g.1657
accatgaatttacggtgagctcagcctagtcataccatttccccagccacatttctccag    c.-3421

.         .         .         .         .         .             g.1717
ctcggggctgactttggaaaaccagagctggggacatgcagttaggggttccccaggact    c.-3361

.         .         .         .         .         .             g.1777
gtgtgatagaaggagagagatccctccttctgggatctctccctgggagctgtggaggag    c.-3301

.         .         .         .         .         .             g.1837
ggaccagaatgatgatcttctaagtaagcctagatgaggagggacatgaagtcagaagca    c.-3241

.         .         .         .         .         .             g.1897
ggtggaaagggagaaagtgcagggtcaaagaactgaaagtgcccaaagattatagcaacc    c.-3181

.         .         .         .         .         .             g.1957
gggcccctgagccaggagctgagaaggtggcaggggcaaaggaagagtttgaagtggtga    c.-3121

.         .         .         .         .         .             g.2017
tttcagaggagatatggtttctggttatgatttaggttcagggtatgcttaaaggagaaa    c.-3061

.         .         .         .         .         .             g.2077
agagctaaggtagagtgtccctgtgattcactcacttattcatttgataaacttttattg    c.-3001

.         .         .         .         .         .             g.2137
agctggtgacacaaacaaggggagagttccacccagccagggtacccagggagggcttcc    c.-2941

.         .         .         .         .         .             g.2197
tggaggaggtggttcttgtgtgggttgagtctagaaagatgaatggaagctctccaggga    c.-2881

.         .         .         .         .         .             g.2257
gacaaagaagatgggtgctctgggaggagagcaaaccacaagcaaaggcatgggggttag    c.-2821

.         .         .         .         .         .             g.2317
ggcaggggggtggaaaacagcttggcccatttgtgaaaatggaggtagcatggccagagg    c.-2761

.         .         .         .         .         .             g.2377
atgcgggaagggtaggcaatgaggcagggatctgatcatggagggccttgggagccctgg    c.-2701

.         .         .         .         .         .             g.2437
gtagggcttaggacgtactcctaagcagtggaaagccattgaagatttaagcagggggtg    c.-2641

.         .         .         .         .         .             g.2497
aaatttgtgactttacaaatatttatggcagtctaggggagagcctggtgggaggtgttt    c.-2581

.         .         .         .         .         .             g.2557
ctttggttggtttttgagacagggtctcactctgtcacccaggctggaggacagtggcac    c.-2521

.         .         .         .         .         .             g.2617
catcatggctcactgcagcctcgaactcctgagcttaagggatcctcctgccttcgtagc    c.-2461

.         .         .         .         .         .             g.2677
tgggactacaggagcatgtcaccacgcggggaggttatttgaacagaacaggtgaggggt    c.-2401

.         .         .         .         .         .             g.2737
ggagggtggagagggcagtgacactggagagggagcatcagtagggtgtggaactggcca    c.-2341

.         .         .         .         .         .             g.2797
gatctaccaccatgatgcttcgggcagccaccaaccaaagccagcttcagcaagtggaac    c.-2281

.         .         .         .         .         .             g.2857
cagtgaggacattcctcccctcacattacaaaacagccagacctcaggggtaatggagga    c.-2221

.         .         .         .         .         .             g.2917
gtaggagaagaggaaattaggaggaagtgaacattttgaagggagaggtgtacgctgtgc    c.-2161

.         .         .         .         .         .             g.2977
aaagaaaacaggctgcagagcaggccccagagaagaagcatcttccaggggcagggaagg    c.-2101

.         .         .         .         .         .             g.3037
ggcaggtcccagagcagagctggggagagtggccggacgcacaggtgatgtcctgctccc    c.-2041

.         .         .         .         .         .             g.3097
aagaagaaaggcggtgtgcggtgtgggaagctcaggagggccagcggggaagaaaacact    c.-1981

.         .         .         .         .         .             g.3157
ggatctgtcccctggggagctctggtgactcaggtgagagtcatttcctcgagtgctggg    c.-1921

.         .         .         .         .         .             g.3217
gttgggagccagactatgtgtctgtgggcttttgtggccctacttgggctcgtgtaatga    c.-1861

.         .         .         .         .         .             g.3277
aaagagtgagcagtatcaggacaggaggatcatcacagcagggactgcagactgggtggg    c.-1801

.         .         .         .         .         .             g.3337
tgcacagcagccctggggtctcttcaaggccatctggctggttggcgccttctgtgtagt    c.-1741

.         .         .         .         .         .             g.3397
gacaagcagcatgtgggggtgtacgtggagtgggtgatggggaggaaggtggcaaggtat    c.-1681

.         .         .         .         .         .             g.3457
atgacagagctgtgagatgcaactgggaaggtctgcatgtggggtggctccaggccgggt    c.-1621

.         .         .         .         .         .             g.3517
gtgcgtgcatgtgcctgtgtgtgcaagtgtgtgcacatgcacgcccacgctcacgacagg    c.-1561

.         .         .         .         .         .             g.3577
ggccagtgagcagctgagggcagggttggcaggaataagcagagtcatccccgtggaaac    c.-1501

.         .         .         .         .         .             g.3637
acgactccctgggtgctgtaaggagcagctgggagccaggcacaagggcgtggccagctc    c.-1441

.         .         .         .         .         .             g.3697
tgcccagtggctctggcctctccctggccaccctccccacctgttgagcaagcctgagaa    c.-1381

.         .         .         .         .         .             g.3757
gcgcccgtgctgaccagggcaggggcgctgctgcaagggtcaaggcccactgggagaggt    c.-1321

.         .         .         .         .         .             g.3817
ccaccctcaggtgtggctttgggggtctctaggggtctgtccaggtccctgtggtgcagg    c.-1261

.         .         .         .         .         .             g.3877
ggtggctccaggtctgtccatgtgggtctggcagtggctgcctgcagctggtctgcaggg    c.-1201

.         .         .         .         .         .             g.3937
gtctcactgcaactgcctgctgatgtggtcattcccccagggccatttgcaataagtgat    c.-1141

.         .         .         .         .         .             g.3997
cccccttcccttccacaggaataggctctggagggctgggcagaaggggagaggggccag    c.-1081

.         .         .         .         .         .             g.4057
gtggggcccagaccacacaatgctcacaggcatcaaaggctccttgtggatgccccttcc    c.-1021

.         .         .         .         .         .             g.4117
cccaatccagcttgtgctgggaccaccagccaaaagcagtccccaggagctctagccctg    c.-961

.         .         .         .         .         .             g.4177
cccccaccattggagttgtccatctccttgtccctgtgaccttccctgtacgtcttctct    c.-901

.         .         .         .         .         .             g.4237
tccacgttagcacctgcagctctccagatgcaatgttcctctcccagttcaccctgcctg    c.-841

.         .         .         .         .         .             g.4297
cccagtgggctagagcccccagggctgtgggagggaactgctaggagacccctgccgggc    c.-781

.         .         .         .         .         .             g.4357
ccagggccctttcttcttccctctcccagcccaacaccaagtaccccaaagatcaggaaa    c.-721

.         .         .         .         .         .             g.4417
gaggaatccacacccacccccatctttcttttcccttccctccaggccagggatggcaaa    c.-661

.         .         .         .         .         .             g.4477
cacaggcagaggcaccacggtcttcctccttgcgcccctggcagacatcactaatcaatc    c.-601

.         .         .         .         .         .             g.4537
acagcaacctttttgcacagagcctggctgccaccttcatggtctccacctacatctcca    c.-541

.         .         .         .         .         .             g.4597
ggtggccaatatcaggatccacgtcggccctcagggtgaagtccctgtgccagtcccact    c.-481

.         .         .         .         .         .             g.4657
ttgatctaaccccccaaccaggcccctcatcctggcctatccagaggtcgcctgagcaca    c.-421

.         .         .         .         .         .             g.4717
gccagctgtggttctctctctgtcccattaggctgaagccacacagttcccggagcttgg    c.-361

.         .         .         .         .         .             g.4777
gcccaggaggcagtcgaaggcactggggtgttgaccccaagtcccaaggccacaaagaat    c.-301

.         .         .         .         .         .             g.4837
ctggttggtttgccgtcggtcctgagggcagccgctgccacttctggggaaagtgtggtg    c.-241

.         .         .         .         .         .             g.4897
ggggggccaggggtgatgctctgtgcccagcacctgtgcagcagcagcaccttgcaggca    c.-181

.         .         .         .         .         .             g.4957
catctcccagtcctgatagagtctgcacgcccacctccccggctcggccactgggcaagc    c.-121

.         .         .         .         .            .          g.5017
aggaggtgaggagtggacggcccgcccagggaggggcggccgc \ ccagcaccccggggctg c.-61


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center