sodium channel, voltage-gated, type IV, beta subunit (SCN4B) - coding DNA reference sequence

(used for variant description)

(last modified October 11, 2014)

This file was created to facilitate the description of sequence variants on transcript NM_001142348.1 in the SCN4B gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000011.9, covering SCN4B transcript NM_001142348.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.5002
                                                           ct       c.-241

 .         .         .         .         .         .                g.5062
 actccttccctcccgccgttgctccagcagccggctcccagcagcgggcgagcgcgcctc       c.-181

 .         .         .         .         .         .                g.5122
 cccctccgctccctccctccccctcctctcgctctctgcccgctaactttcccgagcccc       c.-121

 .         .         .         .         .         .                g.5182
 gaccggcggcgcagagctccggggtagctttgtggccgaacgccgacctcgggcggagag       c.-61

 .         .         .         .         .         .                g.5242
 cgcggctgtgcccagtatcccatccccgcgacccccgcgcgctccggagagaacaggact       c.-1

          .         .         .         .         .         .       g.5302
 ATGCCCGGGGCTGGGGACGGAGGCAAAGCCCCGGCGAGATGGCTGGGCACTGGGCTTTTG       c.60
 M  P  G  A  G  D  G  G  K  A  P  A  R  W  L  G  T  G  L  L         p.20

   | 02      .         .         .         .         .         .    g.16638
 G | TGGAAGAAGTGGACAACACAGTGACACTCATCATCCTGGCTGTCGTGGGCGGGGTCATC    c.120
 V |   E  E  V  D  N  T  V  T  L  I  I  L  A  V  V  G  G  V  I      p.40

          .         .         .         .         .         .       g.16698
 GGGCTCCTCATCCTCATCCTGCTGATCAAGAAACTCATCATCTTCATCCTGAAGAAGACT       c.180
 G  L  L  I  L  I  L  L  I  K  K  L  I  I  F  I  L  K  K  T         p.60

          .  | 03      .         .         .         .         .    g.20844
 CGGGAGAAGAA | GAAGGAGTGTCTCGTGAGCTCCTCGGGGAATGACAACACGGAGAACGGC    c.240
 R  E  K  K  |  K  E  C  L  V  S  S  S  G  N  D  N  T  E  N  G      p.80

          .         .         .         .                           g.20889
 TTGCCTGGCTCCAAGGCAGAGGAGAAACCACCTTCAAAAGTGTGA                      c.285
 L  P  G  S  K  A  E  E  K  P  P  S  K  V  X                        p.94

          .         .         .         .         .         .       g.20949
 gccctgcttcgggctgagcagctgcagggagccccctttctgatgatgaaactgatgctt       c.*60

          .         .         .         .         .         .       g.21009
 gagccccgaccgtagaacccacgtgcctgagacatctgctgcttggctcaaactgtagtc       c.*120

          .         .         .         .         .         .       g.21069
 tttccgggcacaagaaaccagagtcctgcccagcctgcccatccccttcccagtcagggc       c.*180

          .         .         .         .         .         .       g.21129
 tccccagggacaagggatggccaggggagggggtctgtggaagattcaggagaaagaaag       c.*240

          .         .         .         .         .         .       g.21189
 gagaggctagggtggtgtggaggggctggtcccctgacacctgggcagatggggtctcct       c.*300

          .         .         .         .         .         .       g.21249
 tcagtctccctaccctgcacaagcagggccttgattttcctccaggcttctcttcacaag       c.*360

          .         .         .         .         .         .       g.21309
 agactgggaggatccgtaagggatgtcctaagagctgcaccctggagatggggtgtagga       c.*420

          .         .         .         .         .         .       g.21369
 agaagtggcttcctttggaggtgggagtgggctggaggcctctggagaagacctggggtg       c.*480

          .         .         .         .         .         .       g.21429
 ggggctgatgggggcaggcccacagtgagagactgcctctgcttcataggataccagatc       c.*540

          .         .         .         .         .         .       g.21489
 ccccacagtcttccaagtaggaaacttcctttcccctgccccgggaccctatctgcctat       c.*600

          .         .         .         .         .         .       g.21549
 cccctcccctgctcagagtttttaagccctctcaaccagggctggccaccctggtcttga       c.*660

          .         .         .         .         .         .       g.21609
 gggttcctggccacctagcctgctcctctgctctctgggttactgaggggctcaggaagg       c.*720

          .         .         .         .         .         .       g.21669
 ggcccctcgagccttcctggagtacccgagtgctccctatgcctttccaagcatttctac       c.*780

          .         .         .         .         .         .       g.21729
 ttggggaattgggccacagaggtagtgagccagtgtcctgggcctctgggatgcccgccc       c.*840

          .         .         .         .         .         .       g.21789
 cattgctgccaatgctggcagcccctcccctggcatggcaggaccatcgccactctgggc       c.*900

          .         .         .         .         .         .       g.21849
 actcctgagcccagctctcccctgcttctccccctcctacctgagaggctgcaccctcca       c.*960

          .         .         .         .         .         .       g.21909
 acctcccattggctcgctcccccccccccaccgtgccctccatcacgccctgcccccagg       c.*1020

          .         .         .         .         .         .       g.21969
 gtggttcatttcccagccctgggtcaagggcctgccttcgcctcagggactctcttcctt       c.*1080

          .         .         .         .         .         .       g.22029
 tggatgagggggtccttgggtttcccagctgcttcctgctcagctgggccaccccctccc       c.*1140

          .         .         .         .         .         .       g.22089
 accctggggttggggaggagcagggagtgggtgcccacagttttcctttgcttctcccag       c.*1200

          .         .         .         .         .         .       g.22149
 agctggtttgcacagcccttgtgtgtggggctagaatgtgccttagtcctgaatcctagc       c.*1260

          .         .         .         .         .         .       g.22209
 ccttacccccatcctctctagacggtatgtcctgacataacagcagagtctggtgtggtg       c.*1320

          .         .         .         .         .         .       g.22269
 ctggtgagggttcgccagccctcccctccccagggtcatagagggggccatgaggctgga       c.*1380

          .         .         .         .         .         .       g.22329
 attggccagtgactgaatcttggagatgtcggccaggtgctcccattggggtttctagcc       c.*1440

          .         .         .         .         .         .       g.22389
 tgccctagggggaggtggtgatgttgggagtgggatctcctgagtccttgttgggcagaa       c.*1500

          .         .         .         .         .         .       g.22449
 ttggtgaggccagggatggcagggaaaagtggtaacaagcctctctgcccatctacttcc       c.*1560

          .         .         .         .         .         .       g.22509
 aatccctctctcccttactgattttttgatgccctgtcttctgggcccctaggagggatg       c.*1620

          .         .         .         .         .         .       g.22569
 agagaggagtagccccctttttcagagagtttggggtctacctcagagctctccctgtca       c.*1680

          .         .         .         .         .         .       g.22629
 aaaagcagctgcaagcctcgcaagggtggagtggggggagactgaggaccagtagtacct       c.*1740

          .         .         .         .         .         .       g.22689
 gcagggtgcccgtggctgtggccagtgtcccttagccaacctgctgggctcaccagttcc       c.*1800

          .         .         .         .         .         .       g.22749
 ccgtctgatctgcctgtgcgcctcccattcttctctacccagaacctgtcatgggctggg       c.*1860

          .         .         .         .         .         .       g.22809
 gctcagattttcctggctttgggagcagacagaccagagccaccagccattcagaaaact       c.*1920

          .         .         .         .         .         .       g.22869
 tcttatagctaccttcatgcaaaactgttttcttcttccttctcaatggtgacatttgaa       c.*1980

          .         .         .         .         .         .       g.22929
 gaggcagagcaccttggggctcctccttctgtcttaagagaaagccaaggcacgtagagt       c.*2040

          .         .         .         .         .         .       g.22989
 agggagaagaagggcaccatcctctctttcctccccagggtctactgctgatttctagat       c.*2100

          .         .         .         .         .         .       g.23049
 ggatcatgcagcttctctcagctcagctctttccatctaccaaatgggtgtaataatact       c.*2160

          .         .         .         .         .         .       g.23109
 tacctacctcacaggactgttgtgaggcttggcaagttttgtctaaaaacatctttttgg       c.*2220

          .         .         .         .         .         .       g.23169
 cttggaaagggatctgggaagccaggtattaattgcagggatagttccaagtctgtcctg       c.*2280

          .         .         .         .         .         .       g.23229
 tcttcatctctgtgtcccatctctacaacccacatacagacacacacactctctctctct       c.*2340

          .         .         .         .         .         .       g.23289
 ttctttccatcccaccccccttggaattatttagtctttgcaatattagaaaccttgact       c.*2400

          .         .         .         .         .         .       g.23349
 ctgatgcttaaagcttcttgtccatggcttttgtttgatggttttcaatagaggtgactg       c.*2460

          .         .         .         .         .         .       g.23409
 agattgtagggggggcatttttggttgcccccatgcgtgggggcactactaagaatgcta       c.*2520

          .         .         .         .         .         .       g.23469
 aacttagtccccacaacaaagaatcatcctgtcccatgtcaacattatacccatggagaa       c.*2580

          .         .         .         .         .         .       g.23529
 acactggcatggatttgcactaggatgtatatgggcaaagctatcttccccaagtggaac       c.*2640

          .         .         .         .         .         .       g.23589
 ctcagtgcatgcaaatctctgatggtggcttccagggcttgtgggctagagagagccact       c.*2700

          .         .         .         .         .         .       g.23649
 tacaaagtcgatcttgagagacctggccacatgcagctgggctgagtgatgtcagcgaga       c.*2760

          .         .         .         .         .         .       g.23709
 ctaaagacaaagttctgagctcctcatcaactacaaaatatgaaatcagcattccaggtt       c.*2820

          .         .         .         .         .         .       g.23769
 ctgggcttctccccatgtcgtaattgaacagaaggcagcccgaataaacccctgatgtta       c.*2880

          .         .         .         .         .         .       g.23829
 gagaggcctggggagagcagccgatggggctcagactacatatggcaggccgatcagagc       c.*2940

          .         .         .         .         .         .       g.23889
 tcttgtggagcgagggcttgagagcatgcttgtgagatggcaggaggtggggtgtgcttg       c.*3000

          .         .         .         .         .         .       g.23949
 tgtggagtgtgcgtgtgcaggcagtgtgggtgcatggcagcgtaactgtggagtggatgg       c.*3060

          .         .         .         .         .         .       g.24009
 gctctgcatgtaaggggtgatgcatgatgggcagatgctggacatttgaggagccgtctt       c.*3120

          .         .         .         .         .         .       g.24069
 tcttggcctgagctatgcctgttgaggcatctggagactgagaaagaatcaaaggcagag       c.*3180

          .         .         .         .         .         .       g.24129
 aagaccagccgtgctcctgcattccgtcactccatgacttcatctcagtgtcacagacag       c.*3240

          .         .         .         .         .         .       g.24189
 ctgccatcagagggctggcagtagggagttccaggagcggggacttctcgggaaaatcct       c.*3300

          .         .         .         .         .         .       g.24249
 ataacttgctttactttactttgtcccaggttggagtccctaccctcccacctcccacct       c.*3360

          .         .         .         .         .         .       g.24309
 gatatgcagtgcttttgactatcttatgcatggtttattcctctggcttggatgacaaca       c.*3420

          .         .         .         .         .         .       g.24369
 atacccatagtcaattttcctatgtaactatagatcaaatgatgcaacaacaggccttgg       c.*3480

          .         .         .         .         .         .       g.24429
 gaggcctcaggtgtgcgagtgcctctgggaggcgcagatgcccacacagccagcactgac       c.*3540

          .         .         .         .         .         .       g.24489
 ttgtgttcgagcacagaacggatataatcagtctggcctctacaacaagttttgcattgt       c.*3600

          .         .         .         .         .                 g.24539
 agaattgtatttagctttgccttggatgaaataaaaattatgtttaataa                 c.*3650

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Sodium channel, voltage-gated, type IV, beta subunit protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.