succinate dehydrogenase complex assembly factor 2 (SDHAF2) - coding DNA reference sequence

(used for variant description)

(last modified August 19, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_017841.2 in the SDHAF2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_023393.1, covering SDHAF2 transcript NM_017841.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5022
                                       gtttccggtgcaggtggggaaa       c.-1

          .         .         .       | 02 .         .         .    g.12524
 ATGGCGGTGTCTACAGTGTTCTCGACTTCGTCGCTG | ATGCTTGCTCTGTCAAGGCACAGC    c.60
 M  A  V  S  T  V  F  S  T  S  S  L   | M  L  A  L  S  R  H  S      p.20

          .         .         .         .         .         .       g.12584
 CTATTGTCTCCTTTGCTCAGTGTGACATCATTCAGACGCTTCTACAGAGGTGACAGCCCA       c.120
 L  L  S  P  L  L  S  V  T  S  F  R  R  F  Y  R  G  D  S  P         p.40

          .         .         .         .         .         .       g.12644
 ACAGATTCCCAAAAGGACATGATTGAAATCCCTTTGCCTCCATGGCAGGAGAGAACTGAT       c.180
 T  D  S  Q  K  D  M  I  E  I  P  L  P  P  W  Q  E  R  T  D         p.60

          .         .         .         .         .         .       g.12704
 GAATCCATAGAAACCAAAAGAGCCCGCCTGCTCTATGAGAGCAGAAAGAGGGGAATGTTG       c.240
 E  S  I  E  T  K  R  A  R  L  L  Y  E  S  R  K  R  G  M  L         p.80

          .         . | 03       .         .         .         .    g.12919
 GAAAACTGCATTCTTCTTAG | TCTTTTTGCTAAAGAACATCTGCAGCACATGACAGAAAAG    c.300
 E  N  C  I  L  L  S  |  L  F  A  K  E  H  L  Q  H  M  T  E  K      p.100

          .         .         .         .         .         .       g.12979
 CAGCTGAACCTCTATGACCGCCTGATTAACGAGCCTAGTAATGACTGGGATATTTACTAC       c.360
 Q  L  N  L  Y  D  R  L  I  N  E  P  S  N  D  W  D  I  Y  Y         p.120

          . | 04       .         .         .         .         .    g.20866
 TGGGCCACAG | AAGCTAAACCAGCCCCAGAAATATTTGAAAATGAAGTCATGGCCCTGCTG    c.420
 W  A  T  E |   A  K  P  A  P  E  I  F  E  N  E  V  M  A  L  L      p.140

          .         .         .         .         .         .       g.20926
 AGAGACTTTGCTAAAAACAAAAACAAAGAGCAGAGACTGCGTGCCCCAGATCTTGAGTAC       c.480
 R  D  F  A  K  N  K  N  K  E  Q  R  L  R  A  P  D  L  E  Y         p.160

          .         .                                               g.20947
 CTCTTTGAAAAGCCACGTTGA                                              c.501
 L  F  E  K  P  R  X                                                p.166

          .         .         .         .         .         .       g.21007
 gctgtgctccacggcctggcatgggggttcagtctgtggatggtaactacttatgatgga       c.*60

          .         .         .         .         .         .       g.21067
 cgttagccttgcttccggcttcttagatgcccagctgccctaccccagaccactggtcct       c.*120

          .         .         .         .         .         .       g.21127
 gcctcaagtgatggacataaccctctcctaggacatacatgtaaatgcacaatgtgactc       c.*180

          .         .         .         .         .         .       g.21187
 attctcatacttttttgttcagctctgagcctcaaaagtgatttgtcagcagcgctggca       c.*240

          .         .         .         .         .         .       g.21247
 tgcaggctttgcctggctgctatctctagaggcaagtctgccacgagagggcactgcagg       c.*300

          .         .         .         .         .         .       g.21307
 cgaagcagttgtgcttgctcattgcctcagcccaagtgtactcaaagaaaagaggcagcc       c.*360

          .         .         .         .         .         .       g.21367
 agctgtgcgtgctgtatggaaagcctcccgccctccctgcagctccccgccctcagtggc       c.*420

          .         .         .         .         .         .       g.21427
 ccagggctttgttgaagtggaactccccacttccaacctggtatggctccttctgcgaag       c.*480

          .         .         .         .         .         .       g.21487
 ggaagctgatcccagcctcctgagctgaatccttcaaaggcacagcaggcagaatgaggg       c.*540

          .         .         .         .         .         .       g.21547
 ccacaggcaggagtggtgtgggcacactgcttaggagtcaacatcttcatcattgggctt       c.*600

          .         .         .         .         .         .       g.21607
 tctttaaaacgtgcactttgtaatttgaaagagaattattaaagcatactgaaaaaagga       c.*660

          .         .         .                                     g.21643
 aatttacaatttcccagccctcacaattaattttaa                               c.*696

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Succinate dehydrogenase complex assembly factor 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.