succinate dehydrogenase complex, subunit A, flavoprotein (Fp) (SDHA) - coding DNA reference sequence

(used for variant description)

(last modified August 19, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_004168.2 in the SDHA gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012339.1, covering SDHA transcript NM_004168.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5055
      tccggcgtggtgcgcaggcgcggtatcccccctcccccgccagctcgaccccggt       c.-61

 .         .         .         .         .         .                g.5115
 gtggtgcgcaggcgcagtctgcgcagggactggcgggactgcgcggcggcaacagcagac       c.-1

          .         .         .         .         .         .       g.5175
 ATGTCGGGGGTCCGGGGCCTGTCGCGGCTGCTGAGCGCTCGGCGCCTGGCGCTGGCCAAG       c.60
 M  S  G  V  R  G  L  S  R  L  L  S  A  R  R  L  A  L  A  K         p.20

     | 02    .         .         .         .         .         .    g.10298
 GCG | TGGCCAACAGTGTTGCAAACAGGAACCCGAGGTTTTCACTTCACTGTTGATGGGAAC    c.120
 A   | W  P  T  V  L  Q  T  G  T  R  G  F  H  F  T  V  D  G  N      p.40

          .         .         . | 03       .         .         .    g.11149
 AAGAGGGCATCTGCTAAAGTTTCAGATTCC | ATTTCTGCTCAGTATCCAGTAGTGGATCAT    c.180
 K  R  A  S  A  K  V  S  D  S   | I  S  A  Q  Y  P  V  V  D  H      p.60

          .         .         .         .         .         .       g.11209
 GAATTTGATGCAGTGGTGGTAGGCGCTGGAGGGGCAGGCTTGCGAGCTGCATTTGGCCTT       c.240
 E  F  D  A  V  V  V  G  A  G  G  A  G  L  R  A  A  F  G  L         p.80

          .         .         .         .         .         .       g.11269
 TCTGAGGCAGGGTTTAATACAGCATGTGTTACCAAGCTGTTTCCTACCAGGTCACACACT       c.300
 S  E  A  G  F  N  T  A  C  V  T  K  L  F  P  T  R  S  H  T         p.100

          .   | 04     .         .         .         .         .    g.12226
 GTTGCAGCACAG | GGAGGAATCAATGCTGCTCTGGGGAACATGGAGGAGGACAACTGGAGG    c.360
 V  A  A  Q   | G  G  I  N  A  A  L  G  N  M  E  E  D  N  W  R      p.120

          .         .         .         .         .         .       g.12286
 TGGCATTTCTACGACACCGTGAAGGGCTCCGACTGGCTGGGGGACCAGGATGCCATCCAC       c.420
 W  H  F  Y  D  T  V  K  G  S  D  W  L  G  D  Q  D  A  I  H         p.140

          .         .         .       | 05 .         .         .    g.12666
 TACATGACGGAGCAGGCCCCCGCCGCCGTGGTCGAG | CTAGAAAATTATGGCATGCCGTTT    c.480
 Y  M  T  E  Q  A  P  A  A  V  V  E   | L  E  N  Y  G  M  P  F      p.160

          .         .         .         .         .         .       g.12726
 AGCAGAACTGAAGATGGGAAGATTTATCAGCGTGCATTTGGTGGACAGAGCCTCAAGTTT       c.540
 S  R  T  E  D  G  K  I  Y  Q  R  A  F  G  G  Q  S  L  K  F         p.180

          .         .         .         .         .         .       g.12786
 GGAAAGGGCGGGCAGGCCCATCGGTGCTGCTGTGTGGCTGATCGGACTGGCCACTCGCTA       c.600
 G  K  G  G  Q  A  H  R  C  C  C  V  A  D  R  T  G  H  S  L         p.200

          .         .  | 06      .         .         .         .    g.14983
 TTGCACACCTTATATGGAAGG | TCTCTGCGATATGATACCAGCTATTTTGTGGAGTATTTT    c.660
 L  H  T  L  Y  G  R   | S  L  R  Y  D  T  S  Y  F  V  E  Y  F      p.220

          .         .         .         .         .         .       g.15043
 GCCTTGGATCTCCTGATGGAGAATGGGGAGTGCCGTGGTGTCATCGCACTGTGCATAGAG       c.720
 A  L  D  L  L  M  E  N  G  E  C  R  G  V  I  A  L  C  I  E         p.240

          .         .         .         .         . | 07       .    g.17645
 GACGGGTCCATCCATCGCATAAGAGCAAAGAACACTGTTGTTGCCACAGG | AGGCTACGGG    c.780
 D  G  S  I  H  R  I  R  A  K  N  T  V  V  A  T  G  |  G  Y  G      p.260

          .         .         .         .         .         .       g.17705
 CGCACCTACTTCAGCTGCACGTCTGCCCACACCAGCACTGGCGACGGCACGGCCATGATC       c.840
 R  T  Y  F  S  C  T  S  A  H  T  S  T  G  D  G  T  A  M  I         p.280

          .         .         .         .         .      | 08  .    g.20241
 ACCAGGGCAGGCCTTCCTTGCCAGGACCTAGAGTTTGTTCAGTTCCACCCTACAG | GCATA    c.900
 T  R  A  G  L  P  C  Q  D  L  E  F  V  Q  F  H  P  T  G |   I      p.300

          .         .         .         .         .         .       g.20301
 TATGGTGCTGGTTGTCTCATTACGGAAGGATGTCGTGGAGAGGGAGGCATTCTCATTAAC       c.960
 Y  G  A  G  C  L  I  T  E  G  C  R  G  E  G  G  I  L  I  N         p.320

          .         .         .         .         .         .       g.20361
 AGTCAAGGCGAAAGGTTTATGGAGCGATACGCCCCTGTCGCGAAGGACCTGGCGTCTAGA       c.1020
 S  Q  G  E  R  F  M  E  R  Y  A  P  V  A  K  D  L  A  S  R         p.340

          .         .         .         .     | 09   .         .    g.21919
 GATGTGGTGTCTCGGTCCATGACTCTGGAGATCCGAGAAGGAAG | AGGCTGTGGCCCTGAG    c.1080
 D  V  V  S  R  S  M  T  L  E  I  R  E  G  R  |  G  C  G  P  E      p.360

          .         .         .         .         .         .       g.21979
 AAAGATCACGTCTACCTGCAGCTGCACCACCTACCTCCAGAGCAGCTGGCCACGCGCCTG       c.1140
 K  D  H  V  Y  L  Q  L  H  H  L  P  P  E  Q  L  A  T  R  L         p.380

          .         .         .         .         .         .       g.22039
 CCTGGCATTTCAGAGACAGCCATGATCTTCGCTGGCGTGGACGTCACGAAGGAGCCGATC       c.1200
 P  G  I  S  E  T  A  M  I  F  A  G  V  D  V  T  K  E  P  I         p.400

          .         .         .         .         .         .       g.22099
 CCTGTCCTCCCCACCGTGCATTATAACATGGGCGGCATTCCCACCAACTACAAGGGGCAG       c.1260
 P  V  L  P  T  V  H  Y  N  M  G  G  I  P  T  N  Y  K  G  Q         p.420

  | 10       .         .         .         .         .         .    g.23247
  | GTCCTGAGGCACGTGAATGGCCAGGATCAGATTGTGCCCGGCCTGTACGCCTGTGGGGAG    c.1320
  | V  L  R  H  V  N  G  Q  D  Q  I  V  P  G  L  Y  A  C  G  E      p.440

          .         .         .         .         .         .       g.23307
 GCCGCCTGTGCCTCGGTACATGGTGCCAACCGCCTCGGGGCAAACTCGCTCTTGGACCTG       c.1380
 A  A  C  A  S  V  H  G  A  N  R  L  G  A  N  S  L  L  D  L         p.460

          .         .         .         .         .   | 11     .    g.27125
 GTTGTCTTTGGTCGGGCATGTGCCCTGAGCATCGAAGAGTCATGCAGGCCTG | GAGATAAA    c.1440
 V  V  F  G  R  A  C  A  L  S  I  E  E  S  C  R  P  G |   D  K      p.480

          .         .         .         .         .         .       g.27185
 GTCCCTCCAATTAAACCAAACGCTGGGGAAGAATCTGTCATGAATCTTGACAAATTGAGA       c.1500
 V  P  P  I  K  P  N  A  G  E  E  S  V  M  N  L  D  K  L  R         p.500

          .         .         .         .         .  | 12      .    g.37760
 TTTGCTGATGGAAGCATAAGAACATCGGAACTGCGACTCAGCATGCAGAAG | TCAATGCAA    c.1560
 F  A  D  G  S  I  R  T  S  E  L  R  L  S  M  Q  K   | S  M  Q      p.520

          .         .         .         .         .         .       g.37820
 AATCATGCTGCCGTGTTCCGTGTGGGAAGCGTGTTGCAAGAAGGTTGTGGGAAAATCAGC       c.1620
 N  H  A  A  V  F  R  V  G  S  V  L  Q  E  G  C  G  K  I  S         p.540

          .         .         .         .    | 13    .         .    g.38114
 AAGCTCTATGGAGACCTAAAGCACCTGAAGACGTTCGACCGGG | GAATGGTCTGGAACACG    c.1680
 K  L  Y  G  D  L  K  H  L  K  T  F  D  R  G |   M  V  W  N  T      p.560

          .         .         .         .         .         .       g.38174
 GACCTGGTGGAGACCCTGGAGCTGCAGAACCTGATGCTGTGTGCGCTGCAGACCATCTAC       c.1740
 D  L  V  E  T  L  E  L  Q  N  L  M  L  C  A  L  Q  T  I  Y         p.580

          .         .         .         .         .     | 14   .    g.41158
 GGAGCAGAGGCACGGAAGGAGTCACGGGGCGCGCATGCCAGGGAAGACTACAAG | GTGCGG    c.1800
 G  A  E  A  R  K  E  S  R  G  A  H  A  R  E  D  Y  K   | V  R      p.600

          .         .         .         .         .         .       g.41218
 ATTGATGAGTACGATTACTCCAAGCCCATCCAGGGGCAACAGAAGAAGCCCTTTGAGGAG       c.1860
 I  D  E  Y  D  Y  S  K  P  I  Q  G  Q  Q  K  K  P  F  E  E         p.620

          .         .         .         .         | 15         .    g.43105
 CACTGGAGGAAGCACACCCTGTCCTATGTGGACGTTGGCACTGGGAAG | GTCACTCTGGAA    c.1920
 H  W  R  K  H  T  L  S  Y  V  D  V  G  T  G  K   | V  T  L  E      p.640

          .         .         .         .         .         .       g.43165
 TATAGACCCGTGATCGACAAAACTTTGAACGAGGCTGACTGTGCCACCGTCCCGCCAGCC       c.1980
 Y  R  P  V  I  D  K  T  L  N  E  A  D  C  A  T  V  P  P  A         p.660

          .                                                         g.43180
 ATTCGCTCCTACTGA                                                    c.1995
 I  R  S  Y  X                                                      p.664

          .         .         .         .         .         .       g.43240
 tgagacaagatgtggtgatgacagaatcagcttttgtaattatgtataatagctcatgca       c.*60

          .         .         .         .         .         .       g.43300
 tgtgtccatgtcataactgtcttcatacgcttctgcactctggggaagaaggagtacatt       c.*120

          .         .         .         .         .         .       g.43360
 gaagggagattggcacctagtggctgggagcttgccaggaacccagtggccagggagcgt       c.*180

          .         .         .         .         .         .       g.43420
 ggcacttacctttgtcccttgcttcattcttgtgagatgataaaactgggcacagctctt       c.*240

          .         .         .         .                           g.43460
 aaataaaatataaatgaacaaactttcttttatttccaaa                           c.*280

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Succinate dehydrogenase complex, subunit A, flavoprotein (Fp) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 16
©2004-2016 Leiden University Medical Center