succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa (SDHC) - coding DNA reference sequence

(used for variant description)

(last modified August 19, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_003001.3 in the SDHC gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012767.1, covering SDHC transcript NM_003001.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5030
                               gcgtcacttccgtccagaccggaacccaag       c.-1

          .         . | 02       .         .         .         .    g.14278
 ATGGCTGCGCTGTTGCTGAG | ACACGTTGGTCGTCATTGCCTCCGAGCCCACTTTAGCCCT    c.60
 M  A  A  L  L  L  R  |  H  V  G  R  H  C  L  R  A  H  F  S  P      p.20

          .        | 03.         .         .         .         .    g.19063
 CAGCTCTGTATCAGAAA | TGCTGTTCCTTTGGGAACCACGGCCAAAGAAGAGATGGAGCGG    c.120
 Q  L  C  I  R  N  |  A  V  P  L  G  T  T  A  K  E  E  M  E  R      p.40

          .         .         .         .         .          | 04    g.31219
 TTCTGGAATAAGAATATAGGTTCAAACCGTCCTCTGTCTCCCCACATTACTATCTACAG | T    c.180
 F  W  N  K  N  I  G  S  N  R  P  L  S  P  H  I  T  I  Y  S  |      p.60

          .         .         .         .         .         .       g.31279
 TGGTCTCTTCCCATGGCGATGTCCATCTGCCACCGTGGCACTGGTATTGCTTTGAGTGCA       c.240
 W  S  L  P  M  A  M  S  I  C  H  R  G  T  G  I  A  L  S  A         p.80

   | 05      .         .         .         .         .         .    g.47360
 G | GGGTCTCTCTTTTTGGCATGTCGGCCCTGTTACTCCCTGGGAACTTTGAGTCTTATTTG    c.300
 G |   V  S  L  F  G  M  S  A  L  L  L  P  G  N  F  E  S  Y  L      p.100

          .         .         .         .         .         .       g.47420
 GAACTTGTGAAGTCCCTGTGTCTGGGGCCAGCACTGATCCACACAGCTAAGTTTGCACTT       c.360
 E  L  V  K  S  L  C  L  G  P  A  L  I  H  T  A  K  F  A  L         p.120

          .         .         .         .      | 06  .         .    g.52968
 GTCTTCCCTCTCATGTATCATACCTGGAATGGGATCCGACACTTG | ATGTGGGACCTAGGA    c.420
 V  F  P  L  M  Y  H  T  W  N  G  I  R  H  L   | M  W  D  L  G      p.140

          .         .         .         .         .         .       g.53028
 AAAGGCCTGAAGATTCCCCAGCTATACCAGTCTGGAGTGGTTGTCCTGGTTCTTACTGTG       c.480
 K  G  L  K  I  P  Q  L  Y  Q  S  G  V  V  V  L  V  L  T  V         p.160

          .         .         .                                     g.53058
 TTGTCCTCTATGGGGCTGGCAGCCATGTGA                                     c.510
 L  S  S  M  G  L  A  A  M  X                                       p.169

          .         .         .         .         .         .       g.53118
 agaaaggaggctcccagcatcatcttcctacacattattacattcacccatctttctgtt       c.*60

          .         .         .         .         .         .       g.53178
 tgtcattcttatctccagcctgggaaaagttctccttatttgtttagatccttttgtatt       c.*120

          .         .         .         .         .         .       g.53238
 ttcagatctccttggagcagtagagtacctggtagaccataatagtggaaaagggtctag       c.*180

          .         .         .         .         .         .       g.53298
 ttttccccttgtttctaaagatgaggtggctgcaaaaactccccttttttgcccacagct       c.*240

          .         .         .         .         .         .       g.53358
 tgcctactctcggcctagaagcagttattctctctccatattgggctttgatttgtgctg       c.*300

          .         .         .         .         .         .       g.53418
 agggtcagcttttggctccttcttcctgagacagtggaaacaatgccagctctgtggctt       c.*360

          .         .         .         .         .         .       g.53478
 ctgccctggggatgggccgggttggggggtgggttggtgaggctttgggtgccactgcct       c.*420

          .         .         .         .         .         .       g.53538
 gtgggttgctggcttaaaggacaattctcttcattggtgagagcccaggccattaacacc       c.*480

          .         .         .         .         .         .       g.53598
 tacacagtgttattgaaagaagagaggtgggggtggaggggaattagtctgtcccagcta       c.*540

          .         .         .         .         .         .       g.53658
 gagggagataaagagggctagttagttcttggagcagctgcttttgaggagaaaatatat       c.*600

          .         .         .         .         .         .       g.53718
 agctttggacacgaggaagatctagaaaattatcattgaacatattaatggttatttctt       c.*660

          .         .         .         .         .         .       g.53778
 tttcttggatttccagaaaagcctcttaattttatgctttctcatcgaagtaatgtaccc       c.*720

          .         .         .         .         .         .       g.53838
 tttttttctgaaactgaattaaatactcattttatctttgactctccttgaaatctagag       c.*780

          .         .         .         .         .         .       g.53898
 aaaccaagaaaatggctgttgggaaggaaccaatttcctcctcttccctcgggtctcagg       c.*840

          .         .         .         .         .         .       g.53958
 catttacatcctccctctccccgcaatctgacctttaccaggagggaaacagttctccta       c.*900

          .         .         .         .         .         .       g.54018
 catctcatcattggaaaagttttcagggaatcagatagaacttagccagagatttaaata       c.*960

          .         .         .         .         .         .       g.54078
 tcacagaaaagcctcagagaaggaaggagaaaaagaaaagaagtgacgcatgtagagtgc       c.*1020

          .         .         .         .         .         .       g.54138
 ttttgggttataggcaccaaaatcccattaaggactgattataagcttcatggtacagtt       c.*1080

          .         .         .         .         .         .       g.54198
 cagcaaattatgattcattgaggggcacagaggaccagtgttggtgacagctaggggatg       c.*1140

          .         .         .         .         .         .       g.54258
 atgacctgaggttataggcttggggtgaatgaagcatagagtttttttttaaaaaagaag       c.*1200

          .         .         .         .         .         .       g.54318
 ggattgttgaaaacctggcaaaaatgtataatttaatgagaaaacttgctgcttttaaaa       c.*1260

          .         .         .         .         .         .       g.54378
 tccatataggccaggctttagcaggcatgctgttttgatagtttttgggaactctggaat       c.*1320

          .         .         .         .         .         .       g.54438
 aagagacttatctcatctgtcacttcgagttgttggccagccagttaaagctgtgggtcg       c.*1380

          .         .         .         .         .         .       g.54498
 aagaggggaaatgttaactggctggtgtcaattggataggaagaccttagttaaggtggg       c.*1440

          .         .         .         .         .         .       g.54558
 gacccgctgttttaacagtcttcattcagggtcccaaatagtatttggctttaagtaatg       c.*1500

          .         .         .         .         .         .       g.54618
 attggttttccctttttactagaggggccctgggaagtccttgtacctttcctccatttt       c.*1560

          .         .         .         .         .         .       g.54678
 aaaccagctgttctctactttgtccttggaatgagggacaagtgatcatgacagaacact       c.*1620

          .         .         .         .         .         .       g.54738
 ttgtcattgggactgggaaaggtttggcaagggcattaaatttaacagccagtgccagga       c.*1680

          .         .         .         .         .         .       g.54798
 aaatataaaatggggtcaatgataaacagctgttagaggctggaaaatgggtagggcagt       c.*1740

          .         .         .         .         .         .       g.54858
 tgaattttttggtggtttcgtaccatttgggtgattgaagcatggtagtgggtgggtggg       c.*1800

          .         .         .         .         .         .       g.54918
 gggtgtgacagagcatcatgtttgttattctgccttaaatttctacttactgtctttttc       c.*1860

          .         .         .         .         .         .       g.54978
 ttctctgtcttccaatcactttaatatcttcaattttcaaactatatttgtacttgggct       c.*1920

          .         .         .         .         .         .       g.55038
 tagatagaaagtcttacacaagcatagtatcttctactttggttttccctaccttttctt       c.*1980

          .         .         .         .         .         .       g.55098
 ccccaccttctccaaacacacatatacatactctactcaattctatttctgattttgtag       c.*2040

          .         .         .         .         .         .       g.55158
 ttgttagttgtccatgctcaggataaaaaatgagtgggtagggttgagggactggttctt       c.*2100

          .         .         .         .         .         .       g.55218
 tgaggttctgccctttttccatgattcagaccaactttctcttggtcatttctggagtat       c.*2160

          .         .         .         .         .         .       g.55278
 aactgactcaattcttgtaaaaatgtgttccacccaaaccactgtatgttcttttcccta       c.*2220

          .         .         .         .         .         .       g.55338
 ctttattttctcctaccttccttctcctaattgtgttacaagaggcagccatagcaagaa       c.*2280

          .         .         .                                     g.55376
 tggaaaatccagatcagtaaaagattcaacaaaaaaaa                             c.*2318

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 16
©2004-2016 Leiden University Medical Center