succinate dehydrogenase complex, subunit D, integral membrane protein (SDHD) - coding DNA reference sequence

(used for variant description)

(last modified August 19, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_003002.2 in the SDHD gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012337.2, covering SDHD transcript NM_003002.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5001
                                                            g       c.-61

 .         .         .         .         .         .                g.5061
 tgggaattgtcgcctaagtggttccgggttggtggatgaccttgagccctcaggaacgag       c.-1

          .         .         .         .         .   | 02     .    g.6018
 ATGGCGGTTCTCTGGAGGCTGAGTGCCGTTTGCGGTGCCCTAGGAGGCCGAG | CTCTGTTG    c.60
 M  A  V  L  W  R  L  S  A  V  C  G  A  L  G  G  R  A |   L  L      p.20

          .         .         .         .         .         .       g.6078
 CTTCGAACTCCAGTGGTCAGACCTGCTCATATCTCAGCATTTCTTCAGGACCGACCTATC       c.120
 L  R  T  P  V  V  R  P  A  H  I  S  A  F  L  Q  D  R  P  I         p.40

          .         .         .         .          | 03        .    g.7031
 CCAGAATGGTGTGGAGTGCAGCACATACACTTGTCACCGAGCCACCATT | CTGGCTCCAAG    c.180
 P  E  W  C  G  V  Q  H  I  H  L  S  P  S  H  H  S |   G  S  K      p.60

          .         .         .         .         .         .       g.7091
 GCTGCATCTCTCCACTGGACTAGCGAGAGGGTTGTCAGTGTTTTGCTCCTGGGTCTGCTT       c.240
 A  A  S  L  H  W  T  S  E  R  V  V  S  V  L  L  L  G  L  L         p.80

          .         .         .         .         .         .       g.7151
 CCGGCTGCTTATTTGAATCCTTGCTCTGCGATGGACTATTCCCTGGCTGCAGCCCTCACT       c.300
 P  A  A  Y  L  N  P  C  S  A  M  D  Y  S  L  A  A  A  L  T         p.100

          .     | 04   .         .         .         .         .    g.13004
 CTTCATGGTCACTG | GGGCCTTGGACAAGTTGTTACTGACTATGTTCATGGGGATGCCTTG    c.360
 L  H  G  H  W  |  G  L  G  Q  V  V  T  D  Y  V  H  G  D  A  L      p.120

          .         .         .         .         .         .       g.13064
 CAGAAAGCTGCCAAGGCAGGGCTTTTGGCACTTTCAGCTTTAACCTTTGCTGGGCTTTGC       c.420
 Q  K  A  A  K  A  G  L  L  A  L  S  A  L  T  F  A  G  L  C         p.140

          .         .         .         .         .         .       g.13124
 TATTTCAACTATCACGATGTGGGCATCTGCAAAGCTGTTGCCATGCTGTGGAAGCTCTGA       c.480
 Y  F  N  Y  H  D  V  G  I  C  K  A  V  A  M  L  W  K  L  X         p.159

          .         .         .         .         .         .       g.13184
 cctttttgacttcatactttgaagaattgatgtatgcctctttgcctctgctttgtcatg       c.*60

          .         .         .         .         .         .       g.13244
 ccattaagctcacaataaggaagaaataacagataagtccattggtggacagccttcttc       c.*120

          .         .         .         .         .         .       g.13304
 tcttaatcacaagattattttcagaatttaatctttgaggaaaaggtttgagaggaatta       c.*180

          .         .         .         .         .         .       g.13364
 tatctaagttgtgagactgagttctatattctggtgagttaatggggttgcctcccagct       c.*240

          .         .         .         .         .         .       g.13424
 tcttataagactcacagtataactaaacatgatatatcagcttttgcctttcaatttatc       c.*300

          .         .         .         .         .         .       g.13484
 aatctcttaaagagaatccaactttattacgattagtatatgatcaaacttccatatttg       c.*360

          .         .         .         .         .         .       g.13544
 ccttgggaataatggacaaagggaaatactcttaattcatgaataaaaactttgcagaaa       c.*420

          .         .         .         .         .         .       g.13604
 attagacagtgtttaattttcgaaaacttccctctctagacagtagataccacctactga       c.*480

          .         .         .         .         .         .       g.13664
 tggttacatatactagggaaattttaaaattaggaaatgctgatagctcatattataaat       c.*540

          .         .         .         .         .         .       g.13724
 ttctaaatcctaggaagaaacgcttggagtgcttctgaatatacagaagttccatttaag       c.*600

          .         .         .         .         .         .       g.13784
 ggcaagtttccctgtagatgtatcaaaatactaccaactgtaaattgagatttaattccc       c.*660

          .         .         .         .         .         .       g.13844
 aaatgtattctacttgttctaaaacaatctgtccacaaatataaaactataagtaataaa       c.*720

          .         .         .         .         .         .       g.13904
 ttgttattttcgcacaatgggaatctctaatgtgaaaatgtattctatgaaaataatttt       c.*780

          .         .         .         .                           g.13948
 tttaaataaaatgttatataataaaagtgtcttctatgctttta                       c.*824

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Succinate dehydrogenase complex, subunit D, integral membrane protein protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 16
©2004-2016 Leiden University Medical Center