Sec23 homolog B (S. cerevisiae) (SEC23B) - coding DNA reference sequence

(used for variant description)

(last modified March 20, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_032985.4 in the SEC23B gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_016281.1, covering SEC23B transcript NM_032985.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5041
                    gagcatacgtcatcgttctcgctttccggtagctaaggcga       c.-421

 .         .         .         .         .         .                g.5101
 tcagcgggacttcccactgagacgagcggatgtcatattgtatcagggcgaacctctgag       c.-361

 .         .         .         .         .         .                g.5161
 gagcgctggctgcgcttaggcaacggtgcggcaggcgccggggttttctgaaacagaaac       c.-301

 .         .         .         .         .         .                g.5221
 gtttaggggtggggaaacgtgttccgaggaactctcgttttgaagtgcgacatacacctg       c.-241

 .         .         .         .         .         .                g.5281
 tcttgccctgttccaagatggtggcagagcttctctgagtctctcgcttcctccagtccg       c.-181

 .         .         .         .         .         .                g.5341
 tcggagaagcgctctttgattggccagtggacagcgccgtggcatgacgcgctggggcgc       c.-121

 .         .         .         .         .         .                g.5401
 tggccaatcggttgagagctgagctggacttggcggtgggagccggagcctgcttgttgc       c.-61

 .         .         .         .         .      | 02  .             g.8292
 agctgtgggtgaggacggctctagctaggtgagcggctccggccag | ttcccttttagact    c.-1

          .         .         .         .         .         .       g.8352
 ATGGCGACATACCTGGAGTTCATCCAGCAGAATGAAGAACGGGATGGTGTGCGTTTTAGT       c.60
 M  A  T  Y  L  E  F  I  Q  Q  N  E  E  R  D  G  V  R  F  S         p.20

          .         .         .         .         .         .       g.8412
 TGGAACGTGTGGCCTTCCAGCCGGCTGGAGGCTACAAGAATGGTTGTACCCCTGGCTTGT       c.120
 W  N  V  W  P  S  S  R  L  E  A  T  R  M  V  V  P  L  A  C         p.40

          .         .         .         .         .         .       g.8472
 CTCCTTACTCCTTTGAAAGAACGTCCAGACCTACCTCCTGTACAATATGAACCTGTGCTT       c.180
 L  L  T  P  L  K  E  R  P  D  L  P  P  V  Q  Y  E  P  V  L         p.60

          .         .         .         .  | 03      .         .    g.9700
 TGCAGCAGGCCAACTTGTAAAGCTGTTCTCAACCCACTTTG | TCAGGTTGATTATCGAGCA    c.240
 C  S  R  P  T  C  K  A  V  L  N  P  L  C  |  Q  V  D  Y  R  A      p.80

          .         .         .          | 04        .         .    g.13127
 AAACTTTGGGCCTGTAATTTCTGTTTTCAAAGAAATCAG | TTTCCTCCAGCTTATGGAGGC    c.300
 K  L  W  A  C  N  F  C  F  Q  R  N  Q   | F  P  P  A  Y  G  G      p.100

          .         .         .         .         .         .       g.13187
 ATATCTGAGGTGAATCAACCTGCCGAATTGATGCCCCAGTTTTCTACAATTGAGTACGTG       c.360
 I  S  E  V  N  Q  P  A  E  L  M  P  Q  F  S  T  I  E  Y  V         p.120

        | 05 .         .         .         .         .         .    g.21943
 ATACAG | CGAGGTGCTCAGTCCCCTCTGATCTTTCTCTATGTGGTTGACACATGCCTGGAG    c.420
 I  Q   | R  G  A  Q  S  P  L  I  F  L  Y  V  V  D  T  C  L  E      p.140

          .         .         .         .         .         .       g.22003
 GAAGATGACCTTCAAGCACTCAAAGAGTCCCTGCAGATGTCCCTGAGTCTTCTTCCTCCA       c.480
 E  D  D  L  Q  A  L  K  E  S  L  Q  M  S  L  S  L  L  P  P         p.160

          .         .         .         .         .         .       g.22063
 GATGCTCTGGTGGGTCTGATCACATTTGGAAGGATGGTGCAGGTTCATGAGCTAAGCTGT       c.540
 D  A  L  V  G  L  I  T  F  G  R  M  V  Q  V  H  E  L  S  C         p.180

          .         .         .         .         .         .       g.22123
 GAAGGAATCTCCAAAAGTTATGTCTTCCGAGGGACCAAGGATTTAACTGCAAAGCAAATA       c.600
 E  G  I  S  K  S  Y  V  F  R  G  T  K  D  L  T  A  K  Q  I         p.200

     | 06    .         .         .         .         .         .    g.22448
 CAG | GATATGTTGGGCCTGACCAAGCCAGCCATGCCCATGCAGCAAGCACGACCTGCACAA    c.660
 Q   | D  M  L  G  L  T  K  P  A  M  P  M  Q  Q  A  R  P  A  Q      p.220

          .         .          | 07        .         .         .    g.23275
 CCACAGGAGCACCCTTTTGCTTCAAGCAG | ATTTCTGCAGCCTGTTCACAAGATTGATATG    c.720
 P  Q  E  H  P  F  A  S  S  R  |  F  L  Q  P  V  H  K  I  D  M      p.240

          .         .         .         .         .         .       g.23335
 AACCTCACTGATCTTCTTGGGGAGCTACAGAGGGACCCATGGCCAGTAACTCAGGGGAAG       c.780
 N  L  T  D  L  L  G  E  L  Q  R  D  P  W  P  V  T  Q  G  K         p.260

          .         .         .         .         .     | 08   .    g.23835
 AGACCTTTGCGATCCACTGGTGTGGCTTTGTCCATTGCTGTTGGCTTGCTGGAG | GGCACT    c.840
 R  P  L  R  S  T  G  V  A  L  S  I  A  V  G  L  L  E   | G  T      p.280

          .         .         .         .         .         .       g.23895
 TTTCCAAACACAGGAGCCAGGATCATGCTGTTTACTGGAGGTCCCCCTACCCAAGGGCCT       c.900
 F  P  N  T  G  A  R  I  M  L  F  T  G  G  P  P  T  Q  G  P         p.300

          .         .         .         .         .         .       g.23955
 GGCATGGTGGTTGGAGATGAATTAAAGATTCCTATTCGTTCTTGGCATGATATTGAGAAA       c.960
 G  M  V  V  G  D  E  L  K  I  P  I  R  S  W  H  D  I  E  K         p.320

          .         .         .    | 09    .         .         .    g.24979
 GATAATGCACGATTCATGAAAAAGGCAACCAAG | CACTATGAGATGCTTGCTAATCGAACA    c.1020
 D  N  A  R  F  M  K  K  A  T  K   | H  Y  E  M  L  A  N  R  T      p.340

          .         .         .         .         .         .       g.25039
 GCTGCAAATGGTCACTGCATTGATATTTATGCTTGTGCCCTTGATCAAACTGGACTTTTG       c.1080
 A  A  N  G  H  C  I  D  I  Y  A  C  A  L  D  Q  T  G  L  L         p.360

          .         .          | 10        .         .         .    g.28167
 GAGATGAAGTGTTGTGCAAATCTTACTGG | AGGCTACATGGTAATGGGAGATTCTTTCAAC    c.1140
 E  M  K  C  C  A  N  L  T  G  |  G  Y  M  V  M  G  D  S  F  N      p.380

          .         .         .         .         .         .       g.28227
 ACTTCTCTCTTCAAGCAGACATTCCAAAGAATCTTTACTAAAGATTTTAATGGAGATTTC       c.1200
 T  S  L  F  K  Q  T  F  Q  R  I  F  T  K  D  F  N  G  D  F         p.400

          .         .         .    | 11    .         .         .    g.30147
 CGAATGGCATTTGGTGCTACTTTGGACGTAAAG | ACCTCTCGGGAACTGAAGATTGCAGGA    c.1260
 R  M  A  F  G  A  T  L  D  V  K   | T  S  R  E  L  K  I  A  G      p.420

          .         .         .         .         .     | 12   .    g.33115
 GCCATTGGTCCATGCGTATCTCTGAATGTGAAAGGACCGTGTGTGTCAGAAAAT | GAGCTT    c.1320
 A  I  G  P  C  V  S  L  N  V  K  G  P  C  V  S  E  N   | E  L      p.440

          .         .         .         .         .         .       g.33175
 GGTGTTGGTGGCACGAGTCAGTGGAAAATCTGTGGCCTAGATCCTACATCTACACTTGGC       c.1380
 G  V  G  G  T  S  Q  W  K  I  C  G  L  D  P  T  S  T  L  G         p.460

          .         .     | 13   .         .         .         .    g.39788
 ATCTATTTTGAAGTTGTCAATCAG | CACAACACCCCGATCCCCCAAGGAGGCAGAGGAGCC    c.1440
 I  Y  F  E  V  V  N  Q   | H  N  T  P  I  P  Q  G  G  R  G  A      p.480

          .         .         .         .         .         .       g.39848
 ATCCAGTTTGTCACGCATTATCAGCACTCCAGCACCCAGAGACGCATCCGCGTGACCACC       c.1500
 I  Q  F  V  T  H  Y  Q  H  S  S  T  Q  R  R  I  R  V  T  T         p.500

          .  | 14      .         .         .         .         .    g.40524
 ATCGCCCGAAA | TTGGGCAGATGTACAGAGTCAGCTCAGGCACATAGAAGCAGCATTTGAC    c.1560
 I  A  R  N  |  W  A  D  V  Q  S  Q  L  R  H  I  E  A  A  F  D      p.520

          .         .         .         .         .         .       g.40584
 CAGGAGGCTGCGGCAGTGTTGATGGCACGGCTTGGGGTGTTCCGAGCGGAGTCAGAGGAG       c.1620
 Q  E  A  A  A  V  L  M  A  R  L  G  V  F  R  A  E  S  E  E         p.540

          .         .         .         .      | 15  .         .    g.43427
 GGGCCCGATGTGCTCCGGTGGCTGGACCGACAACTCATCCGACTG | TGTCAAAAGTTTGGA    c.1680
 G  P  D  V  L  R  W  L  D  R  Q  L  I  R  L   | C  Q  K  F  G      p.560

          .         .         .         .         .         .       g.43487
 CAGTATAACAAAGAAGACCCCACTTCTTTTAGGTTATCAGATTCCTTTTCTCTATATCCT       c.1740
 Q  Y  N  K  E  D  P  T  S  F  R  L  S  D  S  F  S  L  Y  P         p.580

     | 16    .         .         .         .         .         .    g.46122
 CAG | TTTATGTTCCATCTGAGAAGATCTCCATTTCTTCAAGTGTTTAACAACAGTCCTGAT    c.1800
 Q   | F  M  F  H  L  R  R  S  P  F  L  Q  V  F  N  N  S  P  D      p.600

          .         .         .         .         .         .       g.46182
 GAGTCGTCATATTACAGACATCATTTTGCCCGGCAGGACCTGACCCAGTCCCTCATCATG       c.1860
 E  S  S  Y  Y  R  H  H  F  A  R  Q  D  L  T  Q  S  L  I  M         p.620

          .         .         .         .      | 17  .         .    g.48560
 ATCCAGCCCATTCTCTACTCTTACTCCTTTCATGGGCCACCAGAG | CCAGTACTCTTGGAT    c.1920
 I  Q  P  I  L  Y  S  Y  S  F  H  G  P  P  E   | P  V  L  L  D      p.640

          .         .         .         .         .         .       g.48620
 AGCAGCAGCATTCTAGCTGACAGAATTTTGCTGATGGATACTTTCTTTCAAATTGTCATT       c.1980
 S  S  S  I  L  A  D  R  I  L  L  M  D  T  F  F  Q  I  V  I         p.660

          .   | 18     .         .         .         .         .    g.51739
 TATCTTGGTGAG | ACCATAGCCCAGTGGCGTAAAGCTGGCTACCAGGACATGCCCGAGTAT    c.2040
 Y  L  G  E   | T  I  A  Q  W  R  K  A  G  Y  Q  D  M  P  E  Y      p.680

          .         .         .         .         .         .       g.51799
 GAAAACTTCAAGCACCTTCTGCAGGCACCACTGGATGATGCTCAAGAAATTCTGCAAGCA       c.2100
 E  N  F  K  H  L  L  Q  A  P  L  D  D  A  Q  E  I  L  Q  A         p.700

          .         .         .         .         | 19         .    g.52576
 CGCTTCCCGATGCCACGTTACATCAACACGGAGCATGGAGGCAGTCAG | GCTCGATTCCTT    c.2160
 R  F  P  M  P  R  Y  I  N  T  E  H  G  G  S  Q   | A  R  F  L      p.720

          .         .         .         .         .     | 20   .    g.58113
 TTGTCCAAAGTGAACCCATCTCAGACACACAATAACCTGTATGCTTGGGGACAG | GAAACT    c.2220
 L  S  K  V  N  P  S  Q  T  H  N  N  L  Y  A  W  G  Q   | E  T      p.740

          .         .         .         .         .         .       g.58173
 GGAGCACCCATCCTAACTGATGATGTTAGCCTGCAGGTGTTCATGGACCATTTGAAGAAG       c.2280
 G  A  P  I  L  T  D  D  V  S  L  Q  V  F  M  D  H  L  K  K         p.760

          .         .                                               g.58197
 CTGGCTGTCTCCAGTGCCTGTTAA                                           c.2304
 L  A  V  S  S  A  C  X                                             p.767

          .         .         .         .         .         .       g.58257
 gctgaggatacaaccaggaaatgcaacggtgtcagattgtgttcaaaatgtctagaaagg       c.*60

          .         .         .         .         .         .       g.58317
 cttgataacattcctgttacttttctagcagattttaacaaataatcaaggacattttat       c.*120

          .         .         .         .         .         .       g.58377
 atgtaactctttagattataatttatttgtattcctgtctttgtcctttttcttgcacta       c.*180

          .         .         .         .         .         .       g.58437
 taaaattataaggtcataaatgttttggtacttgtagatgtttatgtgctttttgtatcc       c.*240

          .         .         .         .         .         .       g.58497
 taacttttagaatctaaataaaatcagaggtaatgtattttggcagcttgtttaggtgag       c.*300

          .         .         .         .         .         .       g.58557
 aatcttaatgatcataaaggaaataaatctagatgcagaaagtactggctaaaatattgc       c.*360

          .         .         .         .         .         .       g.58617
 taatacaaatgtgatttcctgaggtctctgtgtgagtgtgtatgtgttttaagtgacttc       c.*420

          .         .         .         .         .         .       g.58677
 cttaagaggtgtttcctgaacctaattctcataattaaagtaatgtatatgcaggatcaa       c.*480

          .         .         .         .         .         .       g.58737
 aatgaaacaaatataccttatcctaaagagctcataacaaataagttacctccactctat       c.*540

          .         .         .         .         .         .       g.58797
 aaactcagacctactttttgaagataactgcttttaacctctccttacaagatttttgtt       c.*600

          .         .         .         .         .         .       g.58857
 gttgatgtatttaattttagcccatgtctcaattctcattttcaaagaatcaatatatta       c.*660

                                                                    g.58863
 atatac                                                             c.*666

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Sec23 homolog B (S. cerevisiae) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 12
©2004-2015 Leiden University Medical Center