sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A (SEMA4A) - 345 nt intron 07 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.15676
gtaaggacctgacccccgctggcctcctttcctgagtcctggtgaccttgctaattcact  c.685+60

         .         .         .         .         .         .  g.15736
caactttcatttgcggaaggtacaatgtgtccattactgttaggcgcagggggtatatgg  c.685+120

         .         .         .         .         .     g.15789
cagggaagaaggcaaagctccggttctcttgaagctttcgtcttatgtaaaca  c.685+173

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.15841
        cattaaagaagtaccagtcatccccaccccacatcgctacccctcgacaagc  c.686-121

.         .         .         .         .         .           g.15901
tgtgggacccgaggaagcctgtgtgtcctggcctccagggccaaaccaacggttttcact  c.686-61

.         .         .         .         .         .           g.15961
caggcaaacccagggcatgcaggggctcagtccctaagcccatctgcccctcccccgcag  c.686-1


Powered by LOVD v.3.0 Build 29
©2004-2024 Leiden University Medical Center