sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A (SEMA4A) - 145 nt intron 12 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.30057
gtgggaagggacctgaccatcaaatggccttccagtggggctggccttgggggcctgttg  c.1434+60

         .     g.30070
ggctggctccctg  c.1434+73

--------------------- middle of intron ---------------------
                                     g.30071      .           g.30082
                                     c.1435-72  ggcctgcaccag  c.1435-61

.         .         .         .         .         .           g.30142
cgtgctgggactttactagatgtggctggggctccctgacaatctccatctctcttccag  c.1435-1


Powered by LOVD v.3.0 Build 29
©2004-2024 Leiden University Medical Center