sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B (SEMA6B) - 378 nt intron 07 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.9346
gtaagtacccccccaacctccatctgatcagccccagccacaggcaagacctggcatttt  c.562+60

         .         .         .         .         .         .  g.9406
ctactccagcgtctgggttgtttagaaggcagctggacgaccacttgtcccagctgtgac  c.562+120

         .         .         .         .         .         .  g.9466
atgggcagactctcagcccaggtttggggctcagctgggattgaggctcagcgggatttg  c.562+180

           g.9475
gggcttagc  c.562+189

--------------------- middle of intron ---------------------
                                        g.9476                g.9484
                                        c.563-189  cggggtcag  c.563-181

.         .         .         .         .         .           g.9544
gggctcagttaaggtcagggcttggatggaggtggggcttggatgggatcagggctcagc  c.563-121

.         .         .         .         .         .           g.9604
ctggagacaggggctcccctaggctcaggactcagtctcagaaaatcgagtttcgaccca  c.563-61

.         .         .         .         .         .           g.9664
cccagcccctggcctctgcggtctcatctcttgcctgccttccccacccaccccatccag  c.563-1


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center