surfactant protein A2 (SFTPA2) - coding DNA reference sequence

(used for variant description)

(last modified February 10, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_001098668.2 in the SFTPA2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_013046.1, covering SFTPA2 transcript NM_001098668.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5037
                        aacttggaggcagagacccaagcagctggaggctctg       c.-61

 .       | 02 .         .         .       | 03 .         .          g.5924
 tgtgtgg | gtcgctgatttcttggagcctgaaaagaag | gagcagcgactggacccagagcc c.-1

          .         .         .         .         .         .       g.5984
 ATGTGGCTGTGCCCTCTGGCCCTCACCCTCATCTTGATGGCAGCCTCTGGTGCTGCGTGC       c.60
 M  W  L  C  P  L  A  L  T  L  I  L  M  A  A  S  G  A  A  C         p.20

          .         .         .         .         .         .       g.6044
 GAAGTGAAGGACGTTTGTGTTGGAAGCCCTGGTATCCCCGGCACTCCTGGATCCCACGGC       c.120
 E  V  K  D  V  C  V  G  S  P  G  I  P  G  T  P  G  S  H  G         p.40

          .         .         .         .         .   | 04     .    g.6410
 CTGCCAGGCAGGGACGGGAGAGATGGTGTCAAAGGAGACCCTGGCCCTCCAG | GCCCCATG    c.180
 L  P  G  R  D  G  R  D  G  V  K  G  D  P  G  P  P  G |   P  M      p.60

          .         .         .         .         .         .       g.6470
 GGTCCGCCTGGAGAAACACCATGTCCTCCTGGGAATAATGGGCTGCCTGGAGCCCCTGGT       c.240
 G  P  P  G  E  T  P  C  P  P  G  N  N  G  L  P  G  A  P  G         p.80

          .         .         .         .         .   | 05     .    g.7286
 GTCCCTGGAGAGCGTGGAGAGAAGGGGGAGGCTGGCGAGAGAGGCCCTCCAG | GGCTTCCA    c.300
 V  P  G  E  R  G  E  K  G  E  A  G  E  R  G  P  P  G |   L  P      p.100

          .         .         .         .         .         .       g.7346
 GCTCATCTAGATGAGGAGCTCCAAGCCACACTCCACGACTTCAGACATCAAATCCTGCAG       c.360
 A  H  L  D  E  E  L  Q  A  T  L  H  D  F  R  H  Q  I  L  Q         p.120

          . | 06       .         .         .         .         .    g.7872
 ACAAGGGGAG | CCCTCAGTCTGCAGGGCTCCATAATGACAGTAGGAGAGAAGGTCTTCTCC    c.420
 T  R  G  A |   L  S  L  Q  G  S  I  M  T  V  G  E  K  V  F  S      p.140

          .         .         .         .         .         .       g.7932
 AGCAATGGGCAGTCCATCACTTTTGATGCCATTCAGGAGGCATGTGCCAGAGCAGGCGGC       c.480
 S  N  G  Q  S  I  T  F  D  A  I  Q  E  A  C  A  R  A  G  G         p.160

          .         .         .         .         .         .       g.7992
 CGCATTGCTGTCCCAAGGAATCCAGAGGAAAATGAGGCCATTGCAAGCTTCGTGAAGAAG       c.540
 R  I  A  V  P  R  N  P  E  E  N  E  A  I  A  S  F  V  K  K         p.180

          .         .         .         .         .         .       g.8052
 TACAACACATATGCCTATGTAGGCCTGACTGAGGGTCCCAGCCCTGGAGACTTCCGCTAC       c.600
 Y  N  T  Y  A  Y  V  G  L  T  E  G  P  S  P  G  D  F  R  Y         p.200

          .         .         .         .         .         .       g.8112
 TCAGATGGGACCCCTGTAAACTACACCAACTGGTACCGAGGGGAGCCTGCAGGTCGGGGA       c.660
 S  D  G  T  P  V  N  Y  T  N  W  Y  R  G  E  P  A  G  R  G         p.220

          .         .         .         .         .         .       g.8172
 AAAGAGCAGTGTGTGGAGATGTACACAGATGGGCAGTGGAATGACAGGAACTGCCTGTAC       c.720
 K  E  Q  C  V  E  M  Y  T  D  G  Q  W  N  D  R  N  C  L  Y         p.240

          .         .                                               g.8199
 TCCCGACTGACCATCTGTGAGTTCTGA                                        c.747
 S  R  L  T  I  C  E  F  X                                          p.248

          .         .         .         .         .         .       g.8259
 gaggcatttaggccatgggacagggaggatcctgtctggccttcagtttccatccccagg       c.*60

          .         .         .         .         .         .       g.8319
 atccacttggtctgtgagatgctagaactccctttcaacagaattcacttgtggctatta       c.*120

          .         .         .         .         .         .       g.8379
 gagctggaggcacccttagccacttcattcccctgatgggccctgactcttccccataat       c.*180

          .         .         .         .         .         .       g.8439
 cactgaccagccttgacactccccttgcaaaccatcccagcactgcaccccaggcagcca       c.*240

          .         .         .         .         .         .       g.8499
 ctcctagccttggcctttggcatgagatggaggcctccttattccccatctggtccagtt       c.*300

          .         .         .         .         .         .       g.8559
 ccttcacttacagatggcagcagtgaggccttggggtagaaggatcctccaaagtcacac       c.*360

          .         .         .         .         .         .       g.8619
 agagtgcctgcctcctggtcccctcagctctgcctctgcagcccactgcctgcccagtgc       c.*420

          .         .         .         .         .         .       g.8679
 catcaggatgagcagtaccggccaagcataatgacagagagaggcagatttcagggaagc       c.*480

          .         .         .         .         .         .       g.8739
 cctgactgtgtggagctaaggacacagtggagattctctggcactctgaggtctctgtgg       c.*540

          .         .         .         .         .         .       g.8799
 caggcctggtcaggctctccaggtggtcagagggcccagtggtgccccagcacggtggtg       c.*600

          .         .         .         .         .         .       g.8859
 cccaagccaaccctgtgactgacatgtacgattcactcctttgagtctttggatgccaac       c.*660

          .         .         .         .         .         .       g.8919
 tcagccccctgacctggaggcagccggccaaggcctctagggaagagccccccactgcag       c.*720

          .         .         .         .         .         .       g.8979
 acatgacccgagtaactttctgctgatgaacaaatctgcaccccacttcagacctcggtg       c.*780

          .         .         .         .         .         .       g.9039
 ggcattcacaccaccccccatgccaccggctccactttccccttttattaatacattcac       c.*840

          .         .         .         .         .         .       g.9099
 ccagataatcattaaaattaacatgtgccaggtcttaggatgtgtcttggggtgggcaca       c.*900

          .         .         .         .         .         .       g.9159
 gtacccggtgactcttggggatatttatttattttccctgagcctatatcttcatctgtg       c.*960

          .         .         .         .         .         .       g.9219
 aaatggggataaaaatacttgttgctgtcacaattattaccatctctccagctagcaaaa       c.*1020

          .         .         .         .         .         .       g.9279
 ttactaccagagccgttactacacacaaaggctattgaccgagcacataccatgtgccac       c.*1080

          .         .         .         .         .         .       g.9339
 acaccttgacaaaatcttttaatacagtttattatgtactattcaatctttacacaatgt       c.*1140

          .         .         .         .         .         .       g.9399
 cacgggaccagtattgtttacccaattttttataaggacactgaagcttagaggagtgaa       c.*1200

          .         .         .         .         .         .       g.9459
 atgttttgagtgttatttcagagagcaaatggcaaagactggatccaaacccatcttcct       c.*1260

          .         .         .         .         .         .       g.9519
 ggacctgaagttcatgctcccagccaccccacccctgagctgaataaagatgatttaagc       c.*1320

          .         .         .                                     g.9556
 ataataaatcgttagtgtgttcacatgagtttccata                              c.*1357

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Surfactant protein A2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.