surfactant protein C (SFTPC) - coding DNA reference sequence

(used for variant description)

(last modified December 22, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_003018.3 in the SFTPC gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_016968.1, covering SFTPC transcript NM_003018.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5038
                       ttctggagggccaggaacaaacaggcttcaaagccaag       c.-121

 .         .         .         .         .         .                g.5098
 ggcttggctggcacacagggggcttggtccttcacctctgtcccctctccctacggacac       c.-61

 .         .         .         .         .         .                g.5158
 atataagaccctggtcacacctgggagaggaggagaggagagcatagcacctgcagcaag       c.-1

          .         .         .         .   | 02     .         .    g.5921
 ATGGATGTGGGCAGCAAAGAGGTCCTGATGGAGAGCCCGCCG | GACTACTCCGCAGCTCCC    c.60
 M  D  V  G  S  K  E  V  L  M  E  S  P  P   | D  Y  S  A  A  P      p.20

          .         .         .         .         .         .       g.5981
 CGGGGCCGATTTGGCATTCCCTGCTGCCCAGTGCACCTGAAACGCCTTCTTATCGTGGTG       c.120
 R  G  R  F  G  I  P  C  C  P  V  H  L  K  R  L  L  I  V  V         p.40

          .         .         .         .         .         .       g.6041
 GTGGTGGTGGTCCTCATCGTCGTGGTGATTGTGGGAGCCCTGCTCATGGGTCTCCACATG       c.180
 V  V  V  V  L  I  V  V  V  I  V  G  A  L  L  M  G  L  H  M         p.60

          .         .  | 03      .         .         .         .    g.6448
 AGCCAGAAACACACGGAGATG | GTTCTGGAGATGAGCATTGGGGCGCCGGAAGCCCAGCAA    c.240
 S  Q  K  H  T  E  M   | V  L  E  M  S  I  G  A  P  E  A  Q  Q      p.80

          .         .         .         .         .         .       g.6508
 CGCCTGGCCCTGAGTGAGCACCTGGTTACCACTGCCACCTTCTCCATCGGCTCCACTGGC       c.300
 R  L  A  L  S  E  H  L  V  T  T  A  T  F  S  I  G  S  T  G         p.100

          .         .     | 04   .         .         .         .    g.6801
 CTCGTGGTGTATGACTACCAGCAG | CTGCTGATCGCCTACAAGCCAGCCCCTGGCACCTGC    c.360
 L  V  V  Y  D  Y  Q  Q   | L  L  I  A  Y  K  P  A  P  G  T  C      p.120

          .         .         .         .         .         .       g.6861
 TGCTACATCATGAAGATAGCTCCAGAGAGCATCCCCAGTCTTGAGGCTCTCACTAGAAAA       c.420
 C  Y  I  M  K  I  A  P  E  S  I  P  S  L  E  A  L  T  R  K         p.140

          .      | 05  .         .         .         .         .    g.7257
 GTCCACAACTTCCAG | ATGGAATGCTCTCTGCAGGCCAAGCCCGCAGTGCCTACGTCTAAG    c.480
 V  H  N  F  Q   | M  E  C  S  L  Q  A  K  P  A  V  P  T  S  K      p.160

          .         .         .         .         .         .       g.7317
 CTGGGCCAGGCAGAGGGGCGAGATGCAGGCTCAGCACCCTCCGGAGGGGACCCGGCCTTC       c.540
 L  G  Q  A  E  G  R  D  A  G  S  A  P  S  G  G  D  P  A  F         p.180

          .         .         .         .         .                 g.7371
 CTGGGCATGGCCGTGAGCACCCTGTGTGGCGAGGTGCCGCTCTACTACATCTAG             c.594
 L  G  M  A  V  S  T  L  C  G  E  V  P  L  Y  Y  I  X               p.197

          .         | 06         .         .         .         .    g.7637
 gacgcctccggtgagcag | ggtcagtggaagccccaacgggaaaggaaacgccccgggcaa    c.*60

          .         .         .         .         .         .       g.7697
 agggtcttttgcagcttttgcagacgggcaagaagctgcttctgcccacaccgcagggac       c.*120

          .         .         .         .         .         .       g.7757
 aagccctggagaaatgggagcttggggagaggatgggagtgggcagaggtggcgcccagg       c.*180

          .         .         .         .         .                 g.7809
 ggcccgggaactcctgccacaacagaataaagcagcctgattgaaaagcaaa               c.*232

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Surfactant protein C protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center