sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein) (SGCG) - coding DNA reference sequence

(used for variant description)

(last modified November 17, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_000231.2 in the SGCG gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_008759.1, covering SGCG transcript NM_000231.2. Some transcripts contain an alternatively splice exon 01b (probably non-coding)


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5035
                          gaaactcgtgagagccctttctccagggacagttg       c.-121
 .         .         .         .         .         .                g.5095
 ctgaagcttcatcctttgctctcattctgtaagtcatagaaaagtttgaaacattctgtc       c.-61
 .         .         .         .         .         .                g.5155
 tgtggtagagctcgggccagctgtagttcattcgccagtgtgcttttcttaatatctaag       c.-1
  | 02       .         .         .         .         .         .    g.27834
  | ATGGTGCGTGAGCAGTACACTACAGCCACAGAAGGCATCTGCATAGAGAGGCCAGAGAAT    c.60
  | M  V  R  E  Q  Y  T  T  A  T  E  G  I  C  I  E  R  P  E  N      p.20
 ^ intron contains alternatively spliced exon 01b . . . . . . g.27894 CAGTATGTCTACAAAATTGGCATTTATGGCTGGAGAAAGCGCTGTCTCTACTTGTTTGTT c.120 Q Y V Y K I G I Y G W R K R C L Y L F V p.40 . . . . . . g.27954 CTTCTTTTACTCATCATCCTCGTTGTGAATTTAGCTCTTACAATTTGGATTCTTAAAGTG c.180 L L L L I I L V V N L A L T I W I L K V p.60 . | 03 . . . . . g.58735 ATGTGGTTTTCTCCA | GCAGGAATGGGCCACTTGTGTGTAACAAAAGATGGACTGCGCTTG c.240 M W F S P | A G M G H L C V T K D G L R L p.80 . . . . . | 04. g.74712 GAAGGGGAATCAGAATTTTTATTCCCATTGTATGCCAAAGAAATACACTCCAGAGTG | GAC c.300 E G E S E F L F P L Y A K E I H S R V | D p.100 . . . . . . g.74772 TCATCTCTGCTTCTACAATCAACCCAGAATGTGACTGTAAATGCGCGCAACTCAGAAGGG c.360 S S L L L Q S T Q N V T V N A R N S E G p.120 . . | 05 . . . . g.103473 GAGGTCACAGGCAGGTTAAAAGTCG | GTCCCAAAATGGTAGAAGTCCAGAATCAACAGTTT c.420 E V T G R L K V G | P K M V E V Q N Q Q F p.140 . . . . . . g.103533 CAGATCAACTCCAACGACGGCAAGCCACTATTTACTGTAGATGAGAAGGAAGTTGTGGTT c.480 Q I N S N D G K P L F T V D E K E V V V p.160 . . | 06 . . . . g.119529 GGTACAGATAAACTTCGAGTAACTG | GGCCTGAAGGGGCTCTTTTTGAACATTCAGTGGAG c.540 G T D K L R V T G | P E G A L F E H S V E p.180 . . . | 07 . . g.144738 ACACCCCTTGTCAGAGCCGACCCGTTTCAAGACCTTAG | ATTAGAATCCCCCACTCGGAGT c.600 T P L V R A D P F Q D L R | L E S P T R S p.200 . . . . . . g.144798 CTAAGCATGGATGCCCCAAGGGGTGTGCATATTCAAGCTCACGCTGGGAAAATTGAGGCG c.660 L S M D A P R G V H I Q A H A G K I E A p.220 . . . . | 08 . . g.148465 CTTTCTCAAATGGATATTCTTTTTCATAGTAGTGATGGAATG | CTTGTGCTTGATGCTGAA c.720 L S Q M D I L F H S S D G M | L V L D A E p.240 . . . . . . g.148525 ACTGTGTGCTTACCCAAGCTGGTGCAGGGGACGTGGGGTCCCTCTGGCAGCTCACAGAGC c.780 T V C L P K L V Q G T W G P S G S S Q S p.260 . . . . . . g.148585 CTCTACGAAATCTGTGTGTGTCCAGATGGGAAGCTGTACCTGTCTGTGGCCGGTGTGAGC c.840 L Y E I C V C P D G K L Y L S V A G V S p.280 . . . g.148621 ACCACGTGCCAGGAGCACAACCACATCTGCCTCTGA c.876 T T C Q E H N H I C L X p.291 . . . . . . g.148681 gctgcctgcgtcctctcggtgagctgtgcagtgccggccccagatcctcacacccaggga c.*60 . . . . . . g.148741 gcagctgcacatcgtgaaagactgaggcagcgtggatgggaagtaaacgcttccagagga c.*120 . . . . . . g.148801 actcagaaaaaattatgtgccagtgaaagtgtttggacaaaaactacatgatctcaaaat c.*180 . . . . . . g.148861 gcacgtggatgtgagacacaaaagttgacaaaatggaaaagcaatgtgtttttccactgg c.*240 . . . . . . g.148921 attaattttcaccggaacaattgcgaattctctctgcctcgcctccccctatcttgtccg c.*300 . . . . . . g.148981 tgtgggcacacactgagtgttgagttgccgtgtggagttaatgtatgacgctccactgtg c.*360 . . . . . . g.149041 gatatctaatgccctgttgagagtagccttgctcagtactaaaatgccccaaagttctat c.*420 . . . . . . g.149101 acagcatttcctttatagcattcaaacctcacatcctcccttcagtttaatgcaagtaag c.*480 . . . . . . g.149161 tcaggtttcacaagaaaattttcaagttttgaagggaatttgaggttgatctggttttca c.*540 . . . . . . g.149221 agatgtagttaaaggaataaatcactcaaaattaaactttctgtatatagtcaataagca c.*600 . . g.149245 ataaaaacctcatttttcagagtt c.*624 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 20b
©2004-2017 Leiden University Medical Center