SH3 domain and tetratricopeptide repeats 2 (SH3TC2) - coding DNA reference sequence

(used for variant description)

(last modified December 23, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_024577.3 in the SH3TC2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007947.2, covering SH3TC2 transcript NM_024577.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5032
                             atatcaaaggctgcattgtgcattgagcaggc       c.-121

 .         .         .         .         .         .                g.5092
 ctcggtccctcgtgtgccagggaggaggcgggaggagggacaccgttgggaggctgtccc       c.-61

 .         .         .         .         .         .                g.5152
 ttgcagcactcttctggcctgtgttcccaagggcctcggccagggtaggatggtacacac       c.-1

          .         .         .         .         .   | 02     .    g.15942
 ATGGGTGGCTGCTTCTGCATCCCCAGGGAGCGGAGTCTGACCCGGGGCCCAG | GTAAAGAA    c.60
 M  G  G  C  F  C  I  P  R  E  R  S  L  T  R  G  P  G |   K  E      p.20

          .         .         .         .         .         .       g.16002
 ACTCCTTCCAAGGATCCAACTGTATCGAGTGAGTGTATAGCCTCATCTGAATACAAGGAA       c.120
 T  P  S  K  D  P  T  V  S  S  E  C  I  A  S  S  E  Y  K  E         p.40

          .         .         .  | 03      .         .         .    g.20214
 AAATGTTTTCTGCCACAGAACATTAATCCAG | ACCTGACACTCTCCTTCTGTGTAAAGAGC    c.180
 K  C  F  L  P  Q  N  I  N  P  D |   L  T  L  S  F  C  V  K  S      p.60

          .         .         .         .         .         .       g.20274
 CGCTCCAGGAGGTGTGTAAATGGACCCCTACAGGAAGCTGCTCGGAGGCGGCTCTGGGCA       c.240
 R  S  R  R  C  V  N  G  P  L  Q  E  A  A  R  R  R  L  W  A         p.80

          .         .         .          | 04        .         .    g.23557
 CTGGAGAATGAGGACCAGGAGGTGCGCATGCTGTTTAAG | GACCTCTCAGCAAGGTTGGTC    c.300
 L  E  N  E  D  Q  E  V  R  M  L  F  K   | D  L  S  A  R  L  V      p.100

          .         .         .         .         .         .       g.23617
 AGTATCCAGTCTCAGAGGGCCCAGTTTCTCATCACCTTCAAGACCATGGAGGAAATCTGG       c.360
 S  I  Q  S  Q  R  A  Q  F  L  I  T  F  K  T  M  E  E  I  W         p.120

          .         .      | 05  .         .         .         .    g.25372
 AAGTTCTCCACCTACCTTAATTTAG | GCTACGTATCCATGTGTCTAGAACATCTCCTCTTT    c.420
 K  F  S  T  Y  L  N  L  G |   Y  V  S  M  C  L  E  H  L  L  F      p.140

          .         .         .         .         .         .       g.25432
 GACCACAAGTACTGGCTCAACTGCATATTGGTGGAGGATACAGAGATCCAAGTGTCTGTA       c.480
 D  H  K  Y  W  L  N  C  I  L  V  E  D  T  E  I  Q  V  S  V         p.160

          .         .         .         .          | 06        .    g.26568
 GATGATAAACACCTGGAAACAATATACCTGGGACTCCTGATACAGGAAG | GCCACTTCTTC    c.540
 D  D  K  H  L  E  T  I  Y  L  G  L  L  I  Q  E  G |   H  F  F      p.180

          .         .         .         .         .         .       g.26628
 TGCAGAGCCCTGTGCTCCGTGACTCCACCAGCCGAGAAGGAAGGGGAATGCTTGACACTT       c.600
 C  R  A  L  C  S  V  T  P  P  A  E  K  E  G  E  C  L  T  L         p.200

          .         .         .         .         .         .       g.26688
 TGCAAGAATGAGTTAATCTCAGTGAAGATGGCAGAAGCTGGCTCCGAGTTGGAAGGCGTG       c.660
 C  K  N  E  L  I  S  V  K  M  A  E  A  G  S  E  L  E  G  V         p.220

          .         .         .         .         .         .       g.26748
 TCTTTGGTGACAGGTCAGCGGGGCCTGGTACTGGTGTCAGCCTTGGAGCCTCTGCCTCTC       c.720
 S  L  V  T  G  Q  R  G  L  V  L  V  S  A  L  E  P  L  P  L         p.240

          .  | 07      .         .         .         .         .    g.27546
 CCTTTCCACCA | GTGGTTCCTAAAGAATTATCCAGGAAGCTGTGGCCTTTCCAGGAAGAGG    c.780
 P  F  H  Q  |  W  F  L  K  N  Y  P  G  S  C  G  L  S  R  K  R      p.260

          .         .      | 08  .         .         .         .    g.29719
 GATTGGACAGGCTCCTATCAGATTG | GCAGAGGACGCTGTAAGGCCTTGACGGGTTATGAG    c.840
 D  W  T  G  S  Y  Q  I  G |   R  G  R  C  K  A  L  T  G  Y  E      p.280

          .         .         .         .         .         .       g.29779
 CCAGGAGAAAAGGATGAACTGAATTTCTACCAGGGAGAAAGCATTGAGATCATCGGCTTT       c.900
 P  G  E  K  D  E  L  N  F  Y  Q  G  E  S  I  E  I  I  G  F         p.300

          .         .         .         .         .         .       g.29839
 GTCATACCTGGGCTTCAGTGGTTCATTGGAAAGTCGACAAGTTCAGGACAAGTGGGCTTT       c.960
 V  I  P  G  L  Q  W  F  I  G  K  S  T  S  S  G  Q  V  G  F         p.320

          .         .         .         .  | 09      .         .    g.36506
 GTCCCCACCAGGAACATAGATCCTGATTCTTATTCCCCAAT | GAGCAGGAACTCTGCCTTT    c.1020
 V  P  T  R  N  I  D  P  D  S  Y  S  P  M  |  S  R  N  S  A  F      p.340

          .         .         .         .         .         .       g.36566
 CTCAGTGATGAGGAGAGATGCTCCCTGTTGGCCCTGGGAAGTGATAAGCAGACTGAGTGT       c.1080
 L  S  D  E  E  R  C  S  L  L  A  L  G  S  D  K  Q  T  E  C         p.360

          .         .         .         .         .      | 10  .    g.39461
 TCCAGCTTCCTCCACACTCTTGCTCGCACTGACATCACATCTGTCTACCGGCTCA | GTGGG    c.1140
 S  S  F  L  H  T  L  A  R  T  D  I  T  S  V  Y  R  L  S |   G      p.380

          .         .         .        | 11.         .         .    g.39643
 TTTGAATCCATCCAGAATCCTCCAAATGATCTGAGTG | CATCCCAGCCTGAAGGTTTCAAG    c.1200
 F  E  S  I  Q  N  P  P  N  D  L  S  A |   S  Q  P  E  G  F  K      p.400

          .         .         .         .         .         .       g.39703
 GAGGTCAGGCCTGGCAGAGCCTGGGAGGAGCATCAGGCCGTGGGGTCCAGACAGTCCAGC       c.1260
 E  V  R  P  G  R  A  W  E  E  H  Q  A  V  G  S  R  Q  S  S         p.420

          .         .         .         .         .         .       g.39763
 AGCTCTGAGGACTCCAGCCTGGAGGAGGAGCTCCTCTCGGCCACCTCAGACAGCTATCGC       c.1320
 S  S  E  D  S  S  L  E  E  E  L  L  S  A  T  S  D  S  Y  R         p.440

          .         .         .         .         .         .       g.39823
 CTGCCGGAGCCTGATGACCTTGATGACCCGGAACTGCTCATGGACCTAAGCACTGGTCAG       c.1380
 L  P  E  P  D  D  L  D  D  P  E  L  L  M  D  L  S  T  G  Q         p.460

          .         .         .         .         .         .       g.39883
 GAGGAGGAGGCTGAGAACTTCGCCCCCATATTGGCTTTTCTGGATCATGAGGGTTATGCT       c.1440
 E  E  E  A  E  N  F  A  P  I  L  A  F  L  D  H  E  G  Y  A         p.480

          .         .         .         .         .         .       g.39943
 GACCACTTTAAGAGTCTCTATGACTTCTCCTTCTCTTTCCTCACTTCTTCCTTTTATAGC       c.1500
 D  H  F  K  S  L  Y  D  F  S  F  S  F  L  T  S  S  F  Y  S         p.500

          .         .         .         .         .         .       g.40003
 TTCTCTGAGGAGGATGAGTTTGTGGCCTACCTGGAGGCATCAAGAAAGTGGGCCAAGAAG       c.1560
 F  S  E  E  D  E  F  V  A  Y  L  E  A  S  R  K  W  A  K  K         p.520

          .         .         .         .         .         .       g.40063
 AGCCACATGACCTGGGCCCATGCCCGTCTCTGCTTCCTCCTGGGCCGGCTGAGCATCAGG       c.1620
 S  H  M  T  W  A  H  A  R  L  C  F  L  L  G  R  L  S  I  R         p.540

          .         .         .         .         .         .       g.40123
 AAGGTCAAACTCTCTCAGGCCAGGGTGTACTTCGAGGAGGCCATCCACATTCTCAATGGA       c.1680
 K  V  K  L  S  Q  A  R  V  Y  F  E  E  A  I  H  I  L  N  G         p.560

          .         .         .         .         .         .       g.40183
 GCATTTGAGGACCTATCCTTGGTGGCCACTCTGTACATCAATTTGGCTGCCATCTACCTG       c.1740
 A  F  E  D  L  S  L  V  A  T  L  Y  I  N  L  A  A  I  Y  L         p.580

          .         .         .         .         .         .       g.40243
 AAACAGAGGCTGAGACATAAAGGCTCCGCCCTGTTGGAAAAGGCAGGTGCCCTGCTGGCC       c.1800
 K  Q  R  L  R  H  K  G  S  A  L  L  E  K  A  G  A  L  L  A         p.600

          .         .         .         .         .         .       g.40303
 TGCCTGCCTGACCGTGAGTCTAGTGCCAAGCATGAACTCGACGTGGTGGCCTACGTGCTG       c.1860
 C  L  P  D  R  E  S  S  A  K  H  E  L  D  V  V  A  Y  V  L         p.620

          .         .         .         .         .         .       g.40363
 CGCCAGGGGATTGTGGTGGGCAGCAGCCCGCTGGAGGCCAGGGCCTGCTTTCTGGCCATC       c.1920
 R  Q  G  I  V  V  G  S  S  P  L  E  A  R  A  C  F  L  A  I         p.640

          .         .         .         .         .         .       g.40423
 CGCTTGCTCCTGAGCCTAGGCCGGCACGAGGAGGTCCTGCCCTTTGCCGAGCGCCTGCAG       c.1980
 R  L  L  L  S  L  G  R  H  E  E  V  L  P  F  A  E  R  L  Q         p.660

          .         .         .         .         .         .       g.40483
 CTCCTCTCTGGACACCCTCCTGCCTCTGAGGCTGTGGCCAGTGTTTTGAGTTTTCTGTAT       c.2040
 L  L  S  G  H  P  P  A  S  E  A  V  A  S  V  L  S  F  L  Y         p.680

          .         .         .         .         .         .       g.40543
 GACAAGAAATATCTTCCACACCTTGCAGTGGCCTCTGTCCAGCAACATGGTATCCAGAGT       c.2100
 D  K  K  Y  L  P  H  L  A  V  A  S  V  Q  Q  H  G  I  Q  S         p.700

          .         .         .         .         .         .       g.40603
 GCCCAAGGGATGTCTCTTCCTATTTGGCAGGTCCACCTTGTCCTCCAGAACACAACCAAG       c.2160
 A  Q  G  M  S  L  P  I  W  Q  V  H  L  V  L  Q  N  T  T  K         p.720

          .         .         .         .         .         .       g.40663
 CTCCTTGGCTTTCCTTCCCCAGGCTGGGGTGAAGTTTCTGCCTTGGCCTGCCCAATGCTC       c.2220
 L  L  G  F  P  S  P  G  W  G  E  V  S  A  L  A  C  P  M  L         p.740

          .         .         .         .         .         .       g.40723
 AGACAGGCCCTGGCTGCCTGTGAGGAACTAGCAGACCGGAGCACCCAGAGGGCCCTGTGT       c.2280
 R  Q  A  L  A  A  C  E  E  L  A  D  R  S  T  Q  R  A  L  C         p.760

          .         .         .         .         .         .       g.40783
 CTCATCCTTTCCAAAGTGTACCTCGAGCACAGGTCTCCTGACGGTGCCATCCACTACCTG       c.2340
 L  I  L  S  K  V  Y  L  E  H  R  S  P  D  G  A  I  H  Y  L         p.780

          .         .         .         .         .         .       g.40843
 AGCCAGGCCTTGGTGCTAGGGCAGCTGCTGGGTGAGCAGGAATCCTTTGAGTCTTCTCTC       c.2400
 S  Q  A  L  V  L  G  Q  L  L  G  E  Q  E  S  F  E  S  S  L         p.800

          .         .         .         .         .         .       g.40903
 TGCCTGGCATGGGCCTATCTCTTAGCCAGCCAGGCCAAGAAGGCTTTGGATGTGCTTGAG       c.2460
 C  L  A  W  A  Y  L  L  A  S  Q  A  K  K  A  L  D  V  L  E         p.820

          .         .         .         .         .         .       g.40963
 CCACTGCTATGCTCCCTGAAGGAGACAGAGAGTCTCACTCAAAGGGGAGTCATCTATAAC       c.2520
 P  L  L  C  S  L  K  E  T  E  S  L  T  Q  R  G  V  I  Y  N         p.840

          .         .         .         .         .         .       g.41023
 CTCCTGGGACTTGCACTCCAAGGTGAAGGCCGGGTGAACAGGGCAGCCAAGAGCTATCTT       c.2580
 L  L  G  L  A  L  Q  G  E  G  R  V  N  R  A  A  K  S  Y  L         p.860

          .         .         .         .         .         .       g.41083
 CGGGCCTTGAACAGAGCCCAGGAGGTGGGAGATGTGCATAACCAGGCAGTGGCTATGGCC       c.2640
 R  A  L  N  R  A  Q  E  V  G  D  V  H  N  Q  A  V  A  M  A         p.880

          .         .         .         .         .         .       g.41143
 AATCTTGGCCACCTGAGCCTTAAGTCCTGGGCTCAGCATCCAGCCAGAAACTATCTCCTG       c.2700
 N  L  G  H  L  S  L  K  S  W  A  Q  H  P  A  R  N  Y  L  L         p.900

          .         .         .         .         .         .       g.41203
 CAGGCTGTACGACTCTATTGTGAACTTCAGGCCAGTAAGGAGACAGACATGGAATTAGTA       c.2760
 Q  A  V  R  L  Y  C  E  L  Q  A  S  K  E  T  D  M  E  L  V         p.920

          .         .         .         .         .         .       g.41263
 CAGGTGTTTCTCTGGTTGGCCCAAGTTCTGGTGTCTGGACACCAGCTGACCCATGGCCTT       c.2820
 Q  V  F  L  W  L  A  Q  V  L  V  S  G  H  Q  L  T  H  G  L         p.940

          .         .         .         .         .   | 12     .    g.41430
 CTTTGTTATGAAATGGCATTGCTGTTTGGCTTAAGGCATCGACATCTAAAGA | GTCAGCTT    c.2880
 L  C  Y  E  M  A  L  L  F  G  L  R  H  R  H  L  K  S |   Q  L      p.960

          .         .         .         .         .         .       g.41490
 CAGGCCACCAAATCCCTCTGCCATTTCTACAGCTCTGTGTCCCCAAACCCTGAGGCATGC       c.2940
 Q  A  T  K  S  L  C  H  F  Y  S  S  V  S  P  N  P  E  A  C         p.980

          .         .         .         .         .         .       g.41550
 ATCACCTACCATGAGCACTGGCTGGCCCTGGCTCAGCAACTCAGGGACCGGGAGATGGAA       c.3000
 I  T  Y  H  E  H  W  L  A  L  A  Q  Q  L  R  D  R  E  M  E         p.1000

          .         .         .         .         .    | 13    .    g.55447
 GGGAGGCTGCTGGAGTCCCTGGGGCAGCTTTATCGGAACCTAAATACCGCCAG | GTCCCTC    c.3060
 G  R  L  L  E  S  L  G  Q  L  Y  R  N  L  N  T  A  R  |  S  L      p.1020

          .         .         .         .         .         .       g.55507
 AGGAGGTCACTCACATGCATCAAGGAGAGCCTGCGTATCTTCATTGACCTGGGGGAGACA       c.3120
 R  R  S  L  T  C  I  K  E  S  L  R  I  F  I  D  L  G  E  T         p.1040

          .         .         .         .         .         .       g.55567
 GACAAGGCTGCTGAGGCCTGGCTTGGGGCGGGGCGACTCCACTACCTCATGCAGGAAGAC       c.3180
 D  K  A  A  E  A  W  L  G  A  G  R  L  H  Y  L  M  Q  E  D         p.1060

          .         .     | 14   .         .         .         .    g.57818
 GAGCTGGTGGAGCTGTGCCTGCAG | GCAGCCATCCAGACAGCCCTGAAGTCAGAGGAGCCT    c.3240
 E  L  V  E  L  C  L  Q   | A  A  I  Q  T  A  L  K  S  E  E  P      p.1080

          .         .         .         .         .         .       g.57878
 TTGCTGGCTCTCAAACTTTATGAAGAAGCAGGTGATGTGTTCTTCAATGGGACCCGCCAC       c.3300
 L  L  A  L  K  L  Y  E  E  A  G  D  V  F  F  N  G  T  R  H         p.1100

          .         .        | 15.         .         .         .    g.59206
 AGGCATCATGCAGTGGAGTACTACCGA | GCTGGAGCTGTTCCTTTAGCAAGGAGGTTGAAG    c.3360
 R  H  H  A  V  E  Y  Y  R   | A  G  A  V  P  L  A  R  R  L  K      p.1120

          .         .         .         .         .         .       g.59266
 GCGGTGAGAACTGAGCTCCGGATTTTCAATAAGCTGACAGAGCTGCAGATTAGCCTCGAA       c.3420
 A  V  R  T  E  L  R  I  F  N  K  L  T  E  L  Q  I  S  L  E         p.1140

          .         .         .         .         .         | 16    g.61099
 GGCTATGAGAAGGCTTTGGAATTTGCCACCCTGGCCGCCAGGCTCAGCACAGTCACAG | GA    c.3480
 G  Y  E  K  A  L  E  F  A  T  L  A  A  R  L  S  T  V  T  G |       p.1160

          .         .         .         .         .         .       g.61159
 GATCAGAGGCAAGAGCTGGTGGCCTTTCACCGCCTGGCTACAGTGTACTACTCCCTGCAC       c.3540
 D  Q  R  Q  E  L  V  A  F  H  R  L  A  T  V  Y  Y  S  L  H         p.1180

          .         .         .         .         .         .       g.61219
 ATGTATGAGATGGCTGAGGACTGCTACCTGAAGACCCTGTCCCTCTGTCCACCATGGCTG       c.3600
 M  Y  E  M  A  E  D  C  Y  L  K  T  L  S  L  C  P  P  W  L         p.1200

          .         .         .         .         .         .       g.61279
 CAGAGTCCCAAGGAGGCCCTGTACTATGCCAAGGTGTATTATCGCCTGGGCAGACTCACC       c.3660
 Q  S  P  K  E  A  L  Y  Y  A  K  V  Y  Y  R  L  G  R  L  T         p.1220

          .      | 17  .         .         .         .         .    g.63317
 TTCTGCCAGCTGAAG | GATGCCCATGATGCCACTGAGTACTTCCTTCTGGCCCTGGCAGCA    c.3720
 F  C  Q  L  K   | D  A  H  D  A  T  E  Y  F  L  L  A  L  A  A      p.1240

          .         .         .         .         .         .       g.63377
 GCGGTCCTGCTGGGTGATGAGGAGCTTCAGGACACCATTAGGAGCAGGCTGGACAACATC       c.3780
 A  V  L  L  G  D  E  E  L  Q  D  T  I  R  S  R  L  D  N  I         p.1260

          .         .         .         .         .         .       g.63437
 TGCCAGAGCCCCCTGTGGCACAGCAGGCCCTCCGGGTGCTCCTCAGAGAGGGCGCGGTGG       c.3840
 C  Q  S  P  L  W  H  S  R  P  S  G  C  S  S  E  R  A  R  W         p.1280

          .         .                                               g.63464
 CTGAGTGGTGGTGGCCTGGCCCTCTGA                                        c.3867
 L  S  G  G  G  L  A  L  X                                          p.1288

          .         .         .         .         .         .       g.63524
 ggaaagctgtcctgtctctggacatttggcatggccagactctgaccccactgccctagg       c.*60

          .         .         .         .         .         .       g.63584
 ctcttaaatactcattgggagggtccgagtccttacctggcctagccccctcatttcaca       c.*120

          .         .         .         .         .         .       g.63644
 agaagaagaatgaagtccaggaggagaagggctcattgcaggccacagaaagatttgatg       c.*180

          .         .         .         .         .         .       g.63704
 gtgcagcgatgagaattcctggttccaggctttgcatctggagcctttaccggttgactg       c.*240

          .         .         .         .         .         .       g.63764
 ttgccttccacacaaacagcctctgaaaagcactttctccatacataattctggagaaga       c.*300

          .         .         .         .         .         .       g.63824
 tgagggatcttgccctccaggagccttccttcctcccccaatgaggaaatcagtcactgc       c.*360

          .         .         .         .         .         .       g.63884
 actggtgcaaaggcaagcagattggaatttgtgctcttcaccgattttctcagggaaaga       c.*420

          .         .         .         .         .         .       g.63944
 ccccttccccttgccagcagaggaacctgtagttttttccatttctttcttcagaaccaa       c.*480

          .         .         .         .         .         .       g.64004
 agtatgtatcactcctcatgctcacagggattgacaggagagaattcaccaggatcttag       c.*540

          .         .         .         .         .         .       g.64064
 ctcaaaagacacagcctcagaatggccagatggattgcacgaaacctgacttggattcac       c.*600

          .         .         .         .         .         .       g.64124
 catcttcctcctgccataaggctgtgctcccacataacctcccagaagctccagggaagc       c.*660

          .         .         .         .         .         .       g.64184
 tttccaagagcaaaggcttggaaattgaatgttaagaaaattatgacataaattacatgt       c.*720

          .         .         .         .         .         .       g.64244
 aaatagtgtatatgattaaatattgtccagttacatttacacacacattttgtctcatcc       c.*780

          .         .         .         .         .         .       g.64304
 acaatgggggcagatgagatggaggacttgatggatgggagagaataccaatacatgtct       c.*840

          .         .         .         .         .         .       g.64364
 tttttttttttttttttttttgagacagtttctcctctgttgcccaggctggagttcagt       c.*900

          .         .         .         .         .         .       g.64424
 ggtacagtcagggcttcctgcgacctcagactccggggctcaagtgatcctccagtgtca       c.*960

          .         .         .         .         .         .       g.64484
 acctcctgagtagctggaactacaggcatgtgccatacccaactacaaggcatcttattg       c.*1020

          .         .         .         .         .         .       g.64544
 atttcagggcagctgctttacaaagcatctctattaataacatcactgcatagcacactg       c.*1080

          .         .         .         .         .         .       g.64604
 agtggcctaaaacacttataatctcatggtttctgaagggcaggaatccaagcatgactt       c.*1140

          .         .         .         .         .         .       g.64664
 agctgagcccaccagcttagggtggttcacaggctgcaatcagctggggctgcagttatc       c.*1200

          .         .         .         .         .         .       g.64724
 tcaacttcaactagagaaggatgggcttccaagctcacccacacagctgttgttaggagt       c.*1260

          .         .         .         .         .         .       g.64784
 cagttttttgctagctgttggccagaggcttcctgcagccacttgccacgtgggcctctc       c.*1320

          .         .         .         .         .         .       g.64844
 cacagggcagtcacaacatggcaccatgcttcactagagggagcaaacaagaggagcaag       c.*1380

          .         .         .         .         .         .       g.64904
 aaccagagtgagcaggagaaaagggagtgactctttctataacctgatcacagaagtgac       c.*1440

          .         .         .         .         .         .       g.64964
 atctccttagtcttgcctattcaattcataataaatgagtcactaggtctagctcccaca       c.*1500

          .         .         .         .         .         .       g.65024
 agaggggagtgtttaccaacagcttgaataccagatggtgaggaatcattggggatcatt       c.*1560

          .         .         .         .         .         .       g.65084
 tcagaagtgacctaccacagtatctgagttctttgataatgaaattgggaattctctaat       c.*1620

          .         .         .         .         .         .       g.65144
 ttcagcaaactgaaaatatggtccactaaccagcagcatcagcatcacctgtgagattgt       c.*1680

          .         .         .         .         .         .       g.65204
 ttgaaatgaaaatctgtggccccacctatgatctctgaatcagaatctctggatcccaga       c.*1740

          .         .         .         .         .         .       g.65264
 acgctgactcgtccaagctttcctggtgattttaatgcaccctaaagtatgggaagcacc       c.*1800

          .         .         .         .         .         .       g.65324
 actgcagggcaagagccctcagatagtgtgcataactattacctggtgaggttgtggaac       c.*1860

          .         .         .         .         .         .       g.65384
 atgaacttcttggtttctatctctaataattctgattcagtagatctgggatgtatccca       c.*1920

          .         .         .         .         .         .       g.65444
 ggaacatgcatttttagaaagcaactcaagcaagcctgatgcaggtggttcacccttgct       c.*1980

          .         .         .         .         .         .       g.65504
 ccttttctgtgaaccacaaggataccagccataattccctgcatctgatgcccatcagct       c.*2040

          .         .         .         .         .         .       g.65564
 tagcttttattatcagaccatctgcccttaatttctagcttcttgggctgaccagatgat       c.*2100

          .         .         .         .         .         .       g.65624
 tggttgtatgaaagggtgagatgggagtggtgagttgagccgccattgcatcttctagtc       c.*2160

          .         .         .         .         .         .       g.65684
 atcaaggttgtctactaattggcacacattttctcttagagatgtggttggttgtcaaaa       c.*2220

          .         .         .         .         .         .       g.65744
 ggctgtctactctagagagtattctccaggaaggagaagcttccagttgtctaattagta       c.*2280

          .         .         .         .         .         .       g.65804
 aagttatctaatctactaccatggagaatagatgtggttttgcccccaccacaagctgta       c.*2340

          .         .         .         .         .         .       g.65864
 aaagccccaagctgggagggacgttgcggttgaggctattcagtctaatctcccgtgcat       c.*2400

          .         .         .         .         .         .       g.65924
 agtcctttcaacaacattcctgggagacagtcaggggcacacacattccagaacagttac       c.*2460

          .         .         .         .         .         .       g.65984
 atatcgtgtatttgaagaaggctcacacagccctggaaaccatgccactggccattcccc       c.*2520

          .         .         .         .         .         .       g.66044
 atctgactcaggttacagatcccctcccttttcccactgaccactcactctcctctggcc       c.*2580

          .         .         .         .         .         .       g.66104
 agatttgtttctgtttctctgaaagagcagttcccacaactgcatgaggcttttgatatt       c.*2640

          .         .         .         .         .         .       g.66164
 ggccggtgggtgaagagtacagagggatgttactatacttaatttgattcttcctctccc       c.*2700

          .         .         .         .         .         .       g.66224
 cagcagccacatctgtccttggcttccattgagctttataatcagttgaaacttctgtgt       c.*2760

          .         .         .         .         .         .       g.66284
 cttctgacttgaacttctgtttggacagatctttctcaattgctgcaaatatgcacatgc       c.*2820

          .         .         .         .         .         .       g.66344
 atttgcatatgcatacacatacacacacatacgtgaagagcgttgtttctatccatgtta       c.*2880

          .         .         .         .         .         .       g.66404
 catctccttggaaattttagctaaaatttcccaattctgtgcactttgatttacctataa       c.*2940

          .         .         .         .         .         .       g.66464
 atctgatgaatttacccataaccaggtcagttataaaaatgtttagcatgtttccaaaga       c.*3000

          .         .         .         .         .         .       g.66524
 caagggtaagactatttttttaaaataagaaaaacattgtgctatataattgcaattact       c.*3060

          .         .         .         .         .         .       g.66584
 acattctatatgtaaaccgcttgctaaaactcttttaaaaagtgtttaaaattttcattt       c.*3120

          .         .         .         .         .         .       g.66644
 ttgaaatgtgggccagctattccctttggaaacatgttgatgctgtctttttttcatgat       c.*3180

          .         .         .         .         .         .       g.66704
 ccacagagagtaaagtggtgattggatttggtctctacttaaacatttaaaaaaataagt       c.*3240

          .         .         .         .         .         .       g.66764
 gtatcatagccaaacatgatctagttaccctctttattctaattgttccctcaaatctta       c.*3300

          .         .         .         .         .         .       g.66824
 tatgggctgtgtgactgctggctccttacatctaatctaaataaagaacaagaagggcat       c.*3360

          .         .         .         .         .         .       g.66884
 tgcaacattgtggaaaaccctgtaacatgttttctcagctttcaggtatactagttccct       c.*3420

          .         .         .         .         .         .       g.66944
 gtccaacagtattaacattctgaaatccaatattgcttttgtccttttcttatttgcttt       c.*3480

          .         .         .         .         .         .       g.67004
 tccattattttaagatgcctttatattgtgcatgtgtatatatatgtatgtgtgtgtgtg       c.*3540

          .         .         .         .         .         .       g.67064
 tgtgttcattttcttcctctttgtaaatataatgcacctcatttggcagaagtttatttg       c.*3600

          .         .         .         .         .         .       g.67124
 gggaagggaatatgcaggaatggagggtgttaggatgagggatcaggaagcctatcacta       c.*3660

          .         .         .         .         .         .       g.67184
 aagggaacctgtattttggtcttgattttgatattaaattgcagtgcgaccttgggcaag       c.*3720

          .         .         .         .         .         .       g.67244
 tcacttaacctctacacatctcagatatttgtcctctgataaaagaacctcacctctggg       c.*3780

          .         .         .         .         .         .       g.67304
 tttttcagcagtgctatttttatactgtatgaataggatgagaaatagtattggagagat       c.*3840

          .         .         .         .         .         .       g.67364
 gaaataatatatttttatagctcaattatattatcttctttttacaggtgagtaaactga       c.*3900

          .         .         .         .         .         .       g.67424
 ggaacagaagggtaactttctcccagacacattggtagttagtggcaaagacagtggtac       c.*3960

          .         .         .         .         .         .       g.67484
 ttgaggcgggggtctcatgactcaaggacttagttgcacaaatgacaggatttctgctgt       c.*4020

          .         .         .         .         .         .       g.67544
 tcagggcttccttcacagttgtgtgtgtatatgtacacgtgtgtgtatgtatgcatgcat       c.*4080

          .         .         .         .         .         .       g.67604
 ttatcacgatatgcaccaaagagcctttacaaaacattttctaaattgatttacttcttt       c.*4140

          .         .         .         .         .         .       g.67664
 tactcatattaacttatttttataagggatgactagtctatatagaagaaaaacttgtat       c.*4200

          .         .         .         .         .         .       g.67724
 tgttttccataaacagaattatgtaaataatggcaaatacaatgaaaataaaataatgca       c.*4260

          .         .         .         .         .         .       g.67784
 ttaacttcaagctaggtcctgttgctcattgcaagcacccagcctaggccttatctggca       c.*4320

          .         .         .         .         .         .       g.67844
 ttgtttgaaaacagagagattaataagtggcagagagtgtagatgacagactagcaacaa       c.*4380

          .         .         .         .         .         .       g.67904
 ccactttttccttgcacactcagagaaatggagtaagcagggaagaggactgagctcctt       c.*4440

          .         .         .         .         .         .       g.67964
 ctgaggagggtcagtgtcattcaatgccaggtttgggcacacatttcagggaagtgggga       c.*4500

          .         .         .         .         .         .       g.68024
 ttcagctgggtgacaggaaaggggcaaatgatatattatgtaatatgattcagtatcaga       c.*4560

          .         .         .         .         .         .       g.68084
 agcattgtgattggtgttagttacaggatgttacaggcactgcggggaagggattttacc       c.*4620

          .         .         .         .         .         .       g.68144
 cagacagggttacgggcatcaggaagggctttctggaggacgtgatatccaaactgagtt       c.*4680

          .         .         .         .         .         .       g.68204
 ctgaaagggacacttacttaattctaactgcagaccagcaggttggtattgacagacagt       c.*4740

          .         .         .         .         .         .       g.68264
 gcatgtgtcaagcaaaggtccagagggtggacagggggtgatgttttctgagaacaggtc       c.*4800

          .         .         .         .         .         .       g.68324
 actctgagtgcagtgaggctggagcagattcagggaagcaaagagggtttggattctacc       c.*4860

          .         .         .         .         .         .       g.68384
 tggaggttgaggggaaggtatagaaggattataagcagttgaaagaaacatggtcagatt       c.*4920

          .         .         .         .         .         .       g.68444
 tgtgctttggaaagatgattctagaagcagcatgagactagattagggcagcagtggaga       c.*4980

          .         .         .         .         .         .       g.68504
 aggtagaaaacacattaggacttggcgattgcaacacaacactccagccttgattcagat       c.*5040

          .         .         .         .         .         .       g.68564
 atcaacagttttccccactaatgttcttctgatcccacattggatttagttgccatattt       c.*5100

          .         .         .         .         .         .       g.68624
 ccctatgcatctctggtctatgacggtttctgcctttccttgtttttcatgaccttgtca       c.*5160

          .         .         .         .         .         .       g.68684
 gttttggtctcttttcctcttttaattgctcccattgagatgtgtggacaagcggcaaag       c.*5220

          .         .         .         .         .         .       g.68744
 aaggaagaaattcaagggaatgggctctgcactcactcaggtggcagctcaggtgggggc       c.*5280

          .         .         .         .         .         .       g.68804
 aatgtaatgtgttttggagttgggcatacttaggttagaatctgtttcttactagctgtg       c.*5340

          .         .         .         .         .         .       g.68864
 tgaccttctgcaaattaattaacttccctgagcccagggctgtcagaattatatcagact       c.*5400

          .         .         .         .         .         .       g.68924
 tacttatgtcatagacaaggaaatggctaaaaaggaaatccatctttggaggcatgtaag       c.*5460

          .         .         .         .         .         .       g.68984
 ccttgacattgagaagtgcagccaaacctggaggtgtggccaggcaccctggtcctgcat       c.*5520

          .         .         .         .         .         .       g.69044
 tcagggacacttgggtctgaagctctttctccttttcatcactgagtgacctgagcaact       c.*5580

          .         .         .         .         .         .       g.69104
 tactttacctctttaagcttcaattattcctctgctcagacttttaattgagacgagatg       c.*5640

          .         .         .         .         .         .       g.69164
 tatggatggcttggtatgaatgtcaattggtggtagctgtcacaatgaagcagaactgag       c.*5700

          .         .         .         .         .         .       g.69224
 tagattcttaataagcacatctattcctgggtcccacaccgttaagcgggagggtgtgta       c.*5760

          .         .         .         .         .         .       g.69284
 tgttaggggtgctctttgctactgggcctctcacttggcggtcttccctcttcggtggga       c.*5820

          .         .         .         .         .         .       g.69344
 cagcatatatttcctgatatgtaccccctcactctcccaactctgtctgattattccaga       c.*5880

          .         .         .         .         .         .       g.69404
 actcaggggacttgaggatggaggctgctggaagtgctggctctgggaatgtgcacttcg       c.*5940

          .         .         .         .         .         .       g.69464
 ttcaccctcctctaaggggtgtcttctccccagagaagcagagacaagtgactgcttagg       c.*6000

          .         .         .         .         .         .       g.69524
 gggtggggattctccccagctgccatggtgcaggatcaagaataacttgcgtggccagga       c.*6060

          .         .         .         .         .         .       g.69584
 ctgcacagtggggctgcttggcttggcttcccagtacagactgcgaggcaggtgagaggg       c.*6120

          .         .         .         .         .         .       g.69644
 aaggatgctgtgctttcaaaacgatttcaaaggtgagaacccagctgccacttctagtgc       c.*6180

          .         .         .         .         .         .       g.69704
 tgcctttgactccttatccagggcatcacactagcttgagggatgaggctctttgagatg       c.*6240

          .         .         .         .         .         .       g.69764
 aacttccagacagggtaggtgagaggatggttgaagtcacatggctaatgagaagacagg       c.*6300

          .         .         .         .         .         .       g.69824
 ctaatccattgctgtccttttctgtgagaaatccaagagttccagtagggggcagtgatg       c.*6360

          .         .         .         .         .         .       g.69884
 tcttcctaaatagtgtatcattggtaaagaacgtatttaatattaatagttctgaatcag       c.*6420

          .         .         .         .         .         .       g.69944
 actagggtagtggctgtcaaatccttttttgttgttatgttgttgttgttgtggcccaca       c.*6480

          .         .         .         .         .         .       g.70004
 gtaagaaatgcattttatggtttatcctcgtgtgcatatgtttgtgcatatgcaacaaca       c.*6540

          .         .         .         .         .         .       g.70064
 tagagaaatgcactcatacattctgttttgttctattcatttttaaaaacattctattct       c.*6600

          .         .         .         .         .         .       g.70124
 agttaaaaaatatcaaatttatgactcaccaaatgaatttctcactcattaacctgtagt       c.*6660

          .         .         .         .         .         .       g.70184
 ttgaaaagtgctgacctggagggtggtctctaaaaaagtgcaggagggctccagcctttg       c.*6720

          .         .         .         .         .         .       g.70244
 ttcttttctatgtattatttgatggatatcttacttctttttgagaccagagagtgtgta       c.*6780

          .         .         .         .         .         .       g.70304
 catctcaaaataaaaataacagttgaggttaatgtgttttatgcattaagtctcatgcaa       c.*6840

          .         .         .         .         .         .       g.70364
 aacctttgtgatgactctcatgtaatcacacaacattttggtgtagttactattattttt       c.*6900

          .         .         .         .         .         .       g.70424
 atctccactgaggtttagagaattgatgtggcttgtctaagtccacagttagtggtgatc       c.*6960

          .         .         .         .         .         .       g.70484
 gaggtgaaatttgaagtcatgtcctctgatgctggagctaggaaatgaaaccattatatt       c.*7020

          .         .         .         .         .         .       g.70544
 atattgtgtttctgtcaggtgacacatctctgagagaaatgctatcactaatatgatcat       c.*7080

          .         .         .         .         .         .       g.70604
 gaatagaagcattagattaaaacttgtttcatcagcctgaaatactgggctgaaatcaac       c.*7140

          .         .         .         .         .         .       g.70664
 acaatcattctggtgtaattgaatcaatcaaaattggttactttagaacaggattggaga       c.*7200

          .         .         .         .         .         .       g.70724
 gaactgactttccaggaggtcttgaaaaagaaatactggtgttattgttgaccacagtca       c.*7260

          .         .         .         .         .         .       g.70784
 ggtaacttagcctagaaaaaaagagagactgcatttcccaaatggaaaatagaaggagga       c.*7320

          .         .         .         .         .         .       g.70844
 acagaaagctttgacctatagtagtgattggtcaaaacaaattataagatcagtaagtta       c.*7380

          .         .         .         .         .         .       g.70904
 tgttttgaagaagattccaggttgggagtgaggtgaatgagggaaacttgcaagagactc       c.*7440

          .         .         .         .         .         .       g.70964
 cagagccaatcgtagaagactatggacatctgaggaagggaagcagccaggtggagtttc       c.*7500

          .         .         .         .         .         .       g.71024
 gtgggtctcacccatcatagtacccgtagctccaatggtggtagcagaaggaagatcatg       c.*7560

          .         .         .         .         .         .       g.71084
 aacatgagagaatagcctacttttgacatcatggaaaaagctattaggaacatccttctc       c.*7620

          .         .         .         .         .         .       g.71144
 atccaaatatgtgttgcaaaacaaatagcctgggaagagcccatgttcatgtacagatgc       c.*7680

          .         .         .         .         .         .       g.71204
 tttgtttcttatgcataaatgttggtagtagcactttttttactcacttagtattcagga       c.*7740

          .         .         .         .         .         .       g.71264
 atgcttaattatctacttccctaaccttccattttactgtatttttatttagggtcacac       c.*7800

          .         .         .         .         .         .       g.71324
 attttactgttatctatgaaaaggattttgaaaatagatacctcgcttctgtcttttatt       c.*7860

          .         .         .         .         .         .       g.71384
 ttaaccttccaaatctagcggaccatagttaaacatgatctgtatgactctcagctactt       c.*7920

          .         .         .         .         .         .       g.71444
 gatcttccttgcacgggccaaatatgtgtgaaggtgacttttttggttattgaactttct       c.*7980

          .         .         .         .         .         .       g.71504
 tgcacatagagaacttctgatgtttgttcatctggggatatatctgacatctacttcata       c.*8040

          .         .         .         .         .         .       g.71564
 gagacattcataggaatgcccctgaattctttgaacattgtaccagacagcaagcagtga       c.*8100

          .         .         .         .         .         .       g.71624
 caatggctacatctgctttcctcctcaggggagctgccacgggctaggctgaaataacag       c.*8160

          .         .         .         .         .         .       g.71684
 ctgcgtggtaatcctggtgaccaaaaagctacttattcataaaacaaaacaaaactaact       c.*8220

          .         .         .         .         .         .       g.71744
 tttgtctgttctagaacatgtagctttggggctgtagtgggtggagggaaaggatagcaa       c.*8280

          .         .         .         .         .         .       g.71804
 acagaaagattacttggaggattttcatttccggttgttttacagtcctaagagcttata       c.*8340

          .         .         .         .         .         .       g.71864
 taaactgatattctgatcctcttccaagtcctgtggcattcttttctttctttccaagtt       c.*8400

          .         .         .         .         .         .       g.71924
 gtataaagtccatctgtctgtttctctctctctctctctttctctcttatttaggcaggg       c.*8460

          .         .         .         .         .         .       g.71984
 tctcactctgttgcccaggctggagtgcagtggggtggccatggttcactgctacctcga       c.*8520

          .         .         .         .         .         .       g.72044
 ccttctagactcaggtgcttgggtgatcctcccacttcagcctcccgagtagctgggact       c.*8580

          .         .         .         .         .         .       g.72104
 acaggcatgtacaaccactcccagctaattttttttttttttggtagtttttgtagagat       c.*8640

          .         .         .         .         .         .       g.72164
 gggtttccaccatgttgcccatgctagtctcaaactcctgggctcaaatcatccacccac       c.*8700

          .         .         .         .         .         .       g.72224
 ctcagccttccaaagtgctggggtaacaggtgtgagccatggcacccggccagttggtct       c.*8760

          .         .         .         .         .         .       g.72284
 cttttttctttttcctcatgtccttagcatctcccttttgcttgtgctcatttgtccctg       c.*8820

          .         .         .         .         .         .       g.72344
 tacttttccttcaaagcacttatcatagtttaaaagtgtactttatgtgagtttttttat       c.*8880

          .         .         .         .         .         .       g.72404
 tttaataatccatgtgcaccacctagattagaagttccatgaaaacaggaatcttatttg       c.*8940

          .         .         .         .         .         .       g.72464
 ggtcactcagctctgtatttctggagcccagcccagtgtctgatgcatggcaggctctca       c.*9000

          .         .         .         .         .         .       g.72524
 ataaagatttgttgaatgggtgaataaaaaaataaaggaatgaaatgttggacttgggtt       c.*9060

          .         .         .         .         .         .       g.72584
 ttgaccttcagggagaaagttttaaaactataatataactacttattgctcatgagtgat       c.*9120

          .         .         .         .         .         .       g.72644
 tgagaaatcaggtgatagggctgctcacatatatagcaggtattcagcaaaagtttattg       c.*9180

          .         .         .         .         .         .       g.72704
 agaataataagcataatttttgtttgtttagaataagttgctatagctgtggtaggtctt       c.*9240

          .         .         .         .         .         .       g.72764
 ttcttaattttcaaacagatagtagtttgaccagggataatcatggtcttttactgaagc       c.*9300

          .         .         .         .         .         .       g.72824
 tgtaatgatggttgtgctaagtaatttacccacagtataggatttgatcctccaaatgat       c.*9360

          .         .         .         .         .         .       g.72884
 cctccaaagaaggtgaccttatctccccttttcaggtgatagaatcaaggtttaaagtat       c.*9420

          .         .         .         .         .         .       g.72944
 ttcagatgtttgcagagattcaaaatcacttttgtctgacctggaaaatcagtgctttat       c.*9480

          .         .         .         .         .         .       g.73004
 ataattatgtaattctgatacacgttttctctttcagaacttaggatcttcaagataaat       c.*9540

          .         .         .         .         .         .       g.73064
 atttctcttttgaacatttgaatgtttccctttgtcttaaggaggagggatgatagaaaa       c.*9600

          .         .         .         .         .         .       g.73124
 tctagggagcagggaccttggcttatataagccttattgcaccaaataccacaggaaatc       c.*9660

          .         .         .         .         .         .       g.73184
 ccttcagtgatgaatgttctatggaataaagatccaggggataggcagtacctttaaggt       c.*9720

          .         .         .         .         .         .       g.73244
 attttgaggcctgagtggtccagagtattgtttcataatcccaagtctctttccttggga       c.*9780

          .         .         .         .         .         .       g.73304
 aatcataagttcatggtattgtgggatgtggataaaaacctcatccttgcccttgagtat       c.*9840

          .         .         .         .         .         .       g.73364
 ctgtcagtctgtttgggggagattggatgcatatatgcaaaggactaggaagaaaagtct       c.*9900

          .         .         .         .         .         .       g.73424
 gagtttagctcctttgggacagaggatgcagacggttatccatctattcatccatctatt       c.*9960

          .         .         .         .         .         .       g.73484
 catccatctattcatccatccatccatccatccatccatccatccatccatccttccatc       c.*10020

          .         .         .         .         .         .       g.73544
 catccattcatttatccaaccagccaattaaccaaccaaccaaccaaccaaccaaccaac       c.*10080

          .         .         .         .         .         .       g.73604
 caaccaaccaaccaaccaaccaaccaaccatctaaccacccaaccacccacatacccaac       c.*10140

          .         .         .         .         .         .       g.73664
 caatgaaacaaccaactaaccaatattcaacacctctcatgtgctaaactcacaatccag       c.*10200

          .         .         .         .         .         .       g.73724
 tgagcaagataatgacagtccctgtcttcataagtcctatgggctccagggcaagtcaga       c.*10260

          .         .         .         .         .         .       g.73784
 gtcctctgataaacttacctattattcttaccatcacagcttagatttgagcacttttac       c.*10320

          .         .         .         .         .         .       g.73844
 ctcaaacactgtactaaaggttatactcttattatatcattgacttctcttaatttctcc       c.*10380

          .         .         .         .         .         .       g.73904
 tacctgcaagaagtaattgcattgtatagttattcacataacacatgtgaagaaatgagt       c.*10440

          .         .         .         .         .         .       g.73964
 tcaaagaggttaagagattaatcttacccaaagtcctgtagatagagagtggcagcttca       c.*10500

          .         .         .         .         .         .       g.74024
 ggacaccagtccaagccttatctatattgcaagtattgcataaaacctcagctgaaattt       c.*10560

          .         .         .         .         .         .       g.74084
 tgataaattttatggaacttaagctagatagatcttgttcacctgaacatcctgtctggg       c.*10620

          .         .         .         .         .         .       g.74144
 atgcatggtagtagactgaacagctccactgcttatgaaatgtgtgacctcaggcaagtt       c.*10680

          .         .         .         .         .         .       g.74204
 gttaagctcttggtgcttcatgtttatcattggcaaatggagatgataatagtacttatc       c.*10740

          .         .         .         .         .         .       g.74264
 tcatgggattgttgtgtggatcaaatgtgtgaatatatgtaaagtgcctggcccatgtta       c.*10800

          .         .         .         .         .         .       g.74324
 tataagtgttggctattattgttattgtgttgacagacatttcagaagagtacttgtttg       c.*10860

          .         .         .         .         .         .       g.74384
 ggcgaagaagttaatgaacacttctttgttgaacctgtggggttaaggcatgcttagagg       c.*10920

          .         .         .         .         .         .       g.74444
 aatgtaatctgggctagatgcttggctattcaagtgagcatgtgacagtgatggtctcag       c.*10980

          .         .         .         .         .         .       g.74504
 tctgcctcccttgtcagagcatcatctgtaaatgattgcctccatcacttaccaagcaca       c.*11040

          .         .         .         .         .         .       g.74564
 gtcacaggaagttgtgacctccctttattggaactgtcattttgaacctatgtttagtct       c.*11100

          .         .         .         .         .         .       g.74624
 ggcagacgttttgacctccgtgatatattgctgagggtgttttgactccatgcttataac       c.*11160

          .         .         .         .         .         .       g.74684
 tacaacattaaaaacaccaataatggctgaatttttatcaagaaagtattttcttaatta       c.*11220

          .         .         .         .         .         .       g.74744
 atgcttactcaatcatttttactccaagataaatgttcaatacagagcagttaaacaatt       c.*11280

          .         .         .         .         .         .       g.74804
 tctacctttttccatcttctattttatcaaaatcattttatggagatgaattcttttgca       c.*11340

          .         .         .         .         .         .       g.74864
 tttggaattttacaatgatggcttataatttattgacaataatttatttaggtcaaattt       c.*11400

          .         .         .         .         .         .       g.74924
 tagcttctgccactgaattttccatcgtagttttatttctactaagtcaaattttcctgg       c.*11460

          .         .         .         .         .         .       g.74984
 tttaaatttgattgatttgaattttattgggataatttgattcccctgtgaatgtttgct       c.*11520

          .         .         .         .         .         .       g.75044
 cattaacacattctttgtgtaggttagctgttgtcagttttattttgaactgattatttc       c.*11580

          .         .         .         .         .         .       g.75104
 aatcgaaacggtgagggacaaatgcctaatcaccttaagcgtctatggaagccaggagtg       c.*11640

          .         .         .         .         .         .       g.75164
 aggccaggtaaaggcagcccagaccagatctaaatgaaacgctgtgggctaagttttcat       c.*11700

          .         .         .         .         .         .       g.75224
 tcacagaagatgggcagagtggcagatcagaggtaactatcaatgatacaaacttcaagg       c.*11760

          .         .         .         .         .         .       g.75284
 aaatgatgagatacagaggaccaaagttaaagtcaatgatatatgtgaagcatgatgatt       c.*11820

          .         .         .         .         .         .       g.75344
 ttccaagccatacccaaaccctatgagctgtgcatgttatacccagcagtttaatcctgg       c.*11880

          .         .         .         .         .         .       g.75404
 aagactcttggtgcatgttgcagggatgagttagctcagtgtgatgtagttaaagagcag       c.*11940

          .         .         .         .         .         .       g.75464
 tgggattggggtcaggtgatctggggtctgaacctagttctgtcactccttgtgtatact       c.*12000

          .         .         .         .         .         .       g.75524
 gggacaagtccatctcccacctgaggtctcagttttaccaactgtcaaaagattgcccta       c.*12060

          .         .         .         .         .         .       g.75584
 aaagttcatagaccccttcgaaaatctgaaaaaaaaaaaaaaaaaaaaaaccaatgaaat       c.*12120

          .         .         .         .         .         .       g.75644
 ctcttcttggaattatgtatacacacccatacacatactttcaaaggcctcatggaccct       c.*12180

          .         .         .         .         .         .       g.75704
 ttaatgcacgcccaaggatgatgagttaaaaacctcagtctcggtaatctgtcaggacct       c.*12240

          .         .         .         .         .         .       g.75764
 gtccagggttgacatgctagggcttaggtaggtgttatatatgtatcctccaggtgatgc       c.*12300

          .         .         .         .         .         .       g.75824
 ctgagaactgacatacatactgcttatggataaaaatggagacatccagaaaagcaggat       c.*12360

          .         .         .         .         .         .       g.75884
 ctggaaccctttgtatgcattgttggtttcttagtgttttcattaatattatgaatggtt       c.*12420

          .         .         .         .         .         .       g.75944
 aagagcataaaccttgggattatgctacctgggtaaaaatccccactgtgtgcatgacct       c.*12480

          .         .         .         .         .         .       g.76004
 tgggcaaggcacttaaccattctgggcctccatttctgcatctgtaatatggaagtatta       c.*12540

          .         .         .         .         .         .       g.76064
 atgatatcaacttcatagggctgttggatgaaacagctaaatgttcaattgttacctctt       c.*12600

          .         .         .         .         .         .       g.76124
 attacctagtgattgaattcatgttctgataattttatgtcatacaaagtggcagctggt       c.*12660

          .         .         .         .         .         .       g.76184
 gggctttggagaccctctagctcagctctgttgttattatatgaaaagtgaaccagaaaa       c.*12720

          .         .         .         .         .         .       g.76244
 gggaaagccttacccatggtcacccaacacatgttagggttgctctctgacactcccctt       c.*12780

          .         .         .         .         .         .       g.76304
 agacaccaggaaagttgagccaccatgacatcatcagcataccagcttccagtgcaagag       c.*12840

          .         .         .         .         .         .       g.76364
 gaggctcacctccatggataaagtcccatgtgatgatctgccatatttgtagagttctct       c.*12900

          .         .         .         .         .         .       g.76424
 gacaccagctgtttctgttgtgagtatagagtgattcagggcaggttggacaccagtgag       c.*12960

          .         .         .         .         .         .       g.76484
 tataatttctacaaaagcagtttgcaagagcctctcattctacctggaaattagtcacac       c.*13020

          .         .         .         .         .         .       g.76544
 tgattctaattacaaggcttttgtgaccccagctgactggccacccctcccagagcaagc       c.*13080

          .         .         .         .         .         .       g.76604
 atttcaaccacccagctgcaatgtctggagactacttgatgttactaccactaaaagaac       c.*13140

          .         .         .         .         .         .       g.76664
 tggagctcctgggggaaacccttcagatataaccactgtattatctgacagaaagcaaaa       c.*13200

          .         .         .         .         .         .       g.76724
 gctaaggtggaagcccactcaagaaacttccaaagactcctgggtcctgggaaatacagg       c.*13260

          .         .         .         .         .         .       g.76784
 atgagcccatatggctaaagttagctttgttgttgagggaactgtagatttaattgctgg       c.*13320

          .         .         .         .         .         .       g.76844
 ctggatggtttgtgttgctactccccacaaagaaattgaccctcttcttcagagcacagc       c.*13380

          .         .         .         .         .         .       g.76904
 aaggggtacacattaccctagtgaaagcaccttctttgccctgctggtttcagctgcagg       c.*13440

          .         .         .         .         .         .       g.76964
 aagtacattcttgcagtatattcactctcacatccaatgtggtatatgggtaaaagcttt       c.*13500

          .         .         .         .         .         .       g.77024
 tgtatagagaagaaaaagtcctctacatatgttaatttctaccccatgtgtagttattgg       c.*13560

          .         .         .         .         .         .       g.77084
 tcttttgctgtgaatgttcctggtgttttaaagggtcatattaaacgttttggggcttct       c.*13620

          .         .         .         .         .         .       g.77144
 gagggattggggttttgaaagtcccctggaaagtgtcaacagatgttcaacaagtgatct       c.*13680

          .         .         .         .         .         .       g.77204
 aattctgggttttgggaaatgaagtttgtgaacttggctgggacctcagggcttggagtc       c.*13740

          .         .         .         .         .         .       g.77264
 agatagctttgggaccttggagacatgacttaacctctctgggtctcagttttctcacct       c.*13800

          .         .         .         .         .         .       g.77324
 gtcaaatgggttatcccagaacttgccttatagaattgctgtgaaaattaaaagagataa       c.*13860

          .         .         .         .         .         .       g.77384
 tgtacttagaatacttaactcagggccttgcttattgcaaatatttaatatataattgct       c.*13920

          .         .         .         .         .         .       g.77444
 attatattttgtatcctgtatactctataataaataacacagctaatgtttactgagcat       c.*13980

          .         .         .         .         .         .       g.77504
 ttatggtgtataaagcattggattaaattctttgaatgcatgatttcattttctgtgttc       c.*14040

          .         .         .         .         .         .       g.77564
 acaacaacctcaagggtggtattattaacatgcccattttataggtgaggaaacaaggtc       c.*14100

          .         .         .         .         .         .       g.77624
 ttggagaagttcagtaacttgtttgaggtccaatagcttgtgagtagcaggggcagaatt       c.*14160

          .         .         .         .         .         .       g.77684
 tgcattcaattgatctggtccaagggcccatgctgttcgccaccaagctgctctgatctc       c.*14220

          .         .         .         .         .         .       g.77744
 cttttgctcctgacttggcttcatcagcatggttgtctttaggttaacctggtcttcccc       c.*14280

          .         .         .         .         .         .       g.77804
 tcaaatcctctcctgtgaaccacttggcagcacaacattgtgtgggtatgtgtgtttgtt       c.*14340

          .         .         .         .         .         .       g.77864
 gacaaaggccagcttgcttatgatgggaggtgtgaacatttacagcaaactaaggaaact       c.*14400

          .         .         .         .         .         .       g.77924
 aaggctcagagaggcatatatctgtacttctaaagaggaacagtttgtcatcttactatg       c.*14460

          .         .         .         .         .         .       g.77984
 aatatattttaaatgaccaatgtcctagtaggagaaaggaactgcaagtgcaagcagaga       c.*14520

          .         .         .         .         .         .       g.78044
 caggaataaatcagagaaagaacaaaacagagtagcctagcgcacccagagcataccatc       c.*14580

          .         .         .         .         .         .       g.78104
 atgaaacctactttggggctatctcagtttccccaggatggttcacccatgagagaaagc       c.*14640

          .         .         .         .         .         .       g.78164
 agggaaaactggcttaagggagctatattttgagtgagaggagaggttgcttggaaatga       c.*14700

          .         .         .         .         .         .       g.78224
 ctcctagaaaagaagcagcccccaccccatcaaacacacacacatacacacaaacatgca       c.*14760

          .         .         .         .         .         .       g.78284
 cacacttgtgtatccccacaccccaagaactcattcttttctgttatgtatctcattttt       c.*14820

          .         .         .         .         .         .       g.78344
 ccccagtgcaggtggattgattcatagggacatttcccaaatgtcctggttgctatatag       c.*14880

          .         .         .         .         .         .       g.78404
 ttcttctctctccgttcattccagctgcttctgaataccagattgttgaagctcttgggt       c.*14940

          .         .         .         .         .         .       g.78464
 ccctgtgactcactctatcctgggtcactctccagatccccttgaatgagtggttccagt       c.*15000

          .         .         .         .         .         .       g.78524
 attcatgttctggaagaatggcataagattttatcagactgttttattatcagtgcaaac       c.*15060

          .         .         .         .         .         .       g.78584
 cggacaatacagaattgtaccaacatctgcagcaatatacataggtggtctgaaaatgtc       c.*15120

          .         .         .         .         .         .       g.78644
 aacactttgcaatccccaaaactcacatgtaagtccttccttcagagtgattttccaagg       c.*15180

          .         .         .         .         .         .       g.78704
 tacacagttctgctgaccaaggtatagctcctgccaaaggattcaacaactacaatgtga       c.*15240

          .         .         .         .         .         .       g.78764
 tttctggatgtgaatgaattcagatattcctcagccatatttatgctggttaaggtagac       c.*15300

          .         .         .         .         .         .       g.78824
 ctaggttcaaatcttgtctcaaagtgcttagtatctgtgtagcattaacaaatcacttta       c.*15360

          .         .         .         .         .         .       g.78884
 tctttctgagctatggctctttcaactgtaaaatggggataataaatacctatatagcaa       c.*15420

          .         .         .         .         .         .       g.78944
 agttattgtaaaattaatgaattaatatgtctaaagcagttagcatggtggctggaatgt       c.*15480

          .         .         .         .         .         .       g.79004
 aataggtcgttaatagattatggctatttttaaaacccatgacttgagcctgtaatcttg       c.*15540

          .         .         .         .         .         .       g.79064
 gaaaaaagactcaaaaagggaattcaatgactccaaaaggaactcaaggaaatataaaga       c.*15600

          .         .         .         .         .         .       g.79124
 aaatacgttaaaaaacaatgacaatagcaaattcttccacaatccaagacattgttttgt       c.*15660

          .         .         .         .         .         .       g.79184
 gtgtgttgtgtgtgttatatgagtgtgtggttggtggttgtttttttatttccttcatgt       c.*15720

          .         .         .         .         .         .       g.79244
 ctgggctcagtagggcacaactagaccagataagggaaacattttgagtgagagagaagg       c.*15780

          .         .         .         .         .         .       g.79304
 ttgcttgcaaatgacatctcaaatccaaagaagaaagcaaagtgataacccttaaacatt       c.*15840

          .         .         .         .         .         .       g.79364
 aaagttatggggatcgtgtttttgaaccatgaggtggaacaagtgacataacaaaccacc       c.*15900

          .         .         .         .         .         .       g.79424
 ccaaaagtttctgatttaaaacagcttatcatcatctgttggtctgatggattgactggg       c.*15960

          .         .         .         .         .         .       g.79484
 ctcacccgggcaattctcgcttgggttctctactgttgttgcagtccaatagtggccaga       c.*16020

          .         .         .         .         .         .       g.79544
 gctggagtcatcaaaggctcctctgggctgggcatcgaagatggcttcctcacggggcta       c.*16080

          .         .         .         .         .         .       g.79604
 acagttgatgcttgcagttggttgggagctcagctggggctgtgatcaactggagccgtg       c.*16140

          .         .         .         .         .         .       g.79664
 agccatgtcgactccatgtggcttggccgtcttacagcatggtggctggttccaagagag       c.*16200

          .         .         .         .         .         .       g.79724
 tgcattccaagagctagcattccaggagattaaacggggagctgcaaagcttcctatgac       c.*16260

          .         .         .         .         .         .       g.79784
 ctggcctcagaagtcacacagtgtcacatctgctatattttattggttatacaaagccag       c.*16320

          .         .         .         .         .         .       g.79844
 cctagagctggtataggaggggattactcaatggcatgagcactgggaagcctggttcac       c.*16380

          .         .         .         .         .         .       g.79904
 ttggggctatcttggggactagatagtaaggcagctttacaagaccagataacattccca       c.*16440

          .         .         .         .         .         .       g.79964
 tctggggtaggatttttgataatgattttcatgtccatgggagaaggagtaaagatgctt       c.*16500

          .         .         .         .         .         .       g.80024
 tgttacccacttttcataaaatctagcttgttctcttgaatcttccaccactcaacttct       c.*16560

          .         .         .         .         .         .       g.80084
 agcctgtgtgcatagagtttttattacccagtaaggccaaaagaacccagccttgtcctt       c.*16620

          .         .         .         .         .         .       g.80144
 aagacatgcaggaaaaatattaggtaagtcaccttctctgtctccaagtgggcagatgat       c.*16680

          .         .         .         .         .         .       g.80204
 atgactctctgtccttggccagaggaggtgcaacagcattctcggcacttccttgtgggt       c.*16740

          .         .         .         .         .         .       g.80264
 atctggagaagtggccaaagtggagatggctcacctttaggtgcactcactatgtaagct       c.*16800

          .         .         .         .         .         .       g.80324
 tactctgggccacagagtggagattttcagatgagaagtttcatgatctaaagaacacac       c.*16860

          .         .         .         .         .         .       g.80384
 acacacacacacacacacacacacacacacacacacacacagattttgaatgaggcctcg       c.*16920

          .         .         .         .         .         .       g.80444
 agtgaggacatgacttggtgagcttcccatgcttgttaagtggtgggagagtgaccacag       c.*16980

          .         .         .         .         .         .       g.80504
 ctttgttcttctcagtcttaatctgatgatcttcactgaatcactccaccacactcgtta       c.*17040

          .         .         .         .         .         .       g.80564
 taaggtttccctttgtttctgtagtcattcctggcacttagttatttcagtgtttatata       c.*17100

          .         .         .         .         .         .       g.80624
 tagtgagactctttgaaaatgctataggtgagaaacccagccaaatatgtggaagtctta       c.*17160

          .         .         .         .         .         .       g.80684
 tggaatatgcccaagactatagatgtaaagaccatgcaggtctgctgtgggatagaaatg       c.*17220

          .         .         .         .         .         .       g.80744
 ttagctggaagctcagcctgatctctcatgaataaggcctgggagagtttcaacacctta       c.*17280

          .         .         .         .         .         .       g.80804
 tctcctcaagtttacttacatactcaataaatagttgttagattccttctatgtgcctgg       c.*17340

          .         .         .         .         .         .       g.80864
 cactgccccaggctgtagcaatagatcaatgaaaaaaacttataaagttcttgtcctctt       c.*17400

          .         .         .         .         .         .       g.80924
 ggcacttgcaatccaatgagaatattcctgaacattcccaatggtgacagatagaaccaa       c.*17460

          .         .         .         .         .         .       g.80984
 tctttgttcagaacaaagaccattggcaaaaatgtgctttttctcctctccccacagagg       c.*17520

          .         .         .         .         .         .       g.81044
 ggttacagtggttaaaataatttaaatcaaattaaatttagaagcatttgatttacacat       c.*17580

          .         .         .         .         .         .       g.81104
 ttcttctaaagtgtgagactaataagatgattttggaatggatctaaaataaagaatttc       c.*17640

          .         .         .         .         .         .       g.81164
 agattagagaattaagcacaatgaactaccatgaaatacattagctggggaattaatatt       c.*17700

          .         .         .         .         .         .       g.81224
 tcattttccaaaaatcattttagaaacaatagctccctggcattgaactggagtctttga       c.*17760

          .         .         .         .         .         .       g.81284
 aaactctgcctctccttggaattcttgatatgacctcatattattgcattgttaaataat       c.*17820

          .         .         .         .         .         .       g.81344
 ctcagcattttttgggtgtaactgttttaacaagttaacacttgatgctgtttatacaac       c.*17880

          .         .         .         .         .         .       g.81404
 gtgtcccttggaggagcaagacagaacaggactgggagattacagcatgggaatgggatt       c.*17940

          .         .         .         .         .         .       g.81464
 taggctcgtcacatttggttgactgagcaattcttatgctctgatttggcttattatgat       c.*18000

          .         .         .         .         .         .       g.81524
 gcctacaagtcaccctaacaagtggcttaataatttgtcaaaaaaggtatctgtcatgta       c.*18060

          .         .         .         .         .         .       g.81584
 ctcaaacctgttgtgtatgaataatctaattgaagttcacttttaaaatgataattcaac       c.*18120

          .         .         .         .         .         .       g.81644
 aagcatttattaagaacttactgcattctaagcaatgtagttgatggaggttgctaccct       c.*18180

          .         .         .         .         .         .       g.81704
 ggcagatcttaactcacaaagggtcagagaaacagcagaaaaatgagtgctatgataaaa       c.*18240

          .         .         .         .         .         .       g.81764
 gtaagacaaggagatgtaatagggagtgagtggggttaccttggctttccagggcttccg       c.*18300

          .         .         .         .         .         .       g.81824
 ttttctcactaagtctatcatttagagctgggacctaatggaagatctctaaggttcttt       c.*18360

          .         .         .         .         .         .       g.81884
 tagttctaacatttagtaatcacatgatttgtgctattaggtttttagaacagtcactag       c.*18420

          .         .         .         .         .         .       g.81944
 caatgtctgttttttaattagcacaatatttaattgctttctgatttcagatacattttt       c.*18480

          .         .         .         .         .         .       g.82004
 tttctcttgttcttacaaaaaccctgcagagatgaagaagctgtggtttaaggcagttat       c.*18540

          .         .         .         .         .         .       g.82064
 gtaacatacccaagttcacacgggcagtaaaataggctattaagcagggccttagtgagt       c.*18600

          .         .         .         .         .         .       g.82124
 gaaaattgattataattggatcaaaacagccttacttaaagaagttgaactaatgagttc       c.*18660

          .         .         .         .         .         .       g.82184
 taatttccttttaaacaccaagattctgcatttatgtgtttttcaaaaatcaccctagag       c.*18720

          .         .         .         .         .         .       g.82244
 atgatactctgtaagtctcatgtcagaaaaatgatcgagtggtatctataggttactttg       c.*18780

          .         .         .         .         .         .       g.82304
 ctcccagcacagacatgaagtcttttgagccctaatggagatatgatagtgggccaaatc       c.*18840

          .         .         .         .         .         .       g.82364
 tatataaaaatgacattccacacattgaaaaataaaagtggctattgctgctgggaatgc       c.*18900

          .         .         .         .         .         .       g.82424
 aaaatgaaacagctgttttggaaaatgctttgatagtttcttataaattaaacatacact       c.*18960

          .         .         .         .         .         .       g.82484
 tacaaagtgatccagaattgctactcctaggtatttatatcaaagaaatgaaaacttatg       c.*19020

          .         .         .         .         .         .       g.82544
 tatacaaaagcctatacacaaatgtttagagtggatttattcatagttgccagaaattgg       c.*19080

          .         .         .         .         .         .       g.82604
 aacaacccaatgtcttcaaactgggaaatggataaacaaactatggtgtattcatacagt       c.*19140

          .         .         .         .         .         .       g.82664
 ggaatactactcagtaataaaaagaaatgagcacccaatacatgcaacaacttggagtta       c.*19200

          .         .         .         .         .         .       g.82724
 catcaaatgcattatgctaattagaggaagtcagacttaaaatgctacatactgtatata       c.*19260

          .         .         .         .         .         .       g.82784
 atccatatggcattttaaaaactacaggatcagcaaacagatctgtgctgtgagttggag       c.*19320

          .         .         .         .         .         .       g.82844
 gaagaattgatgaaaaaagacacaagaaaattgtttgaagtgatggagctgttctatatc       c.*19380

          .         .         .         .         .         .       g.82904
 ttgattgtagtagtgatggcattgaatgcatttgccaaaactcatagaactctgtaacta       c.*19440

          .         .         .         .         .         .       g.82964
 aaaaataatgaattttattatatataaattataccttcataacagggtaccctcaaatga       c.*19500

          .         .         .         .         .         .       g.83024
 gtagtaatatatttttgcgtgtgttttgattttaagtgctttgagtgaatagtttttttt       c.*19560

          .         .         .         .         .         .       g.83084
 ttttccagaaaagtagctcattcttattcagtgtttgttttctgaggatgtcaagtggag       c.*19620

          .         .         .         .         .         .       g.83144
 tcagaaccaataaaagttctatcaagaagagtctcagttaaccagattagcttgcccagg       c.*19680

          .         .         .         .         .         .       g.83204
 ttggtggaaccatgaaaaccagattaaaaataatgggagtaatcttccattgcttccatc       c.*19740

          .         .         .         .         .         .       g.83264
 cctaggattcacttcctgtcctgttttatacactttgtaaatggtacctctataacccat       c.*19800

          .         .         .         .         .         .       g.83324
 tatgctttttggcatcattgctcactttgactatttgcagattacaaattatttgaggtc       c.*19860

          .         .         .         .         .         .       g.83384
 aaagaagtgagtggagtacataaccttcaaggtgaagcaggaagcagatgcctccttctg       c.*19920

          .         .         .         .         .         .       g.83444
 agtataagttctcttaggtcagatactgggaacaaatttgtttacagcaccaagcacagc       c.*19980

          .         .         .         .         .         .       g.83504
 tctttgagggttggaatacccactaaacatctaagcaaatgtggacatttacccttcagg       c.*20040

          .         .         .         .         .         .       g.83564
 gatacatgctgacaaattccttcctatatgccaacctgaaagaccaaccttggagatata       c.*20100

          .         .         .         .         .         .       g.83624
 tgaagcattgcctagtccagagtgaggcagaagactgagtcaggggtttcgacttagtca       c.*20160

          .         .         .         .         .         .       g.83684
 aggaatgctcaattttcaccttttccctcttcctgcataccttcctcatgagtcatgagc       c.*20220

          .         .         .         .         .         .       g.83744
 ccagacaaggccccagggtttttcccaatatagttcttcaggaagtcactataagtcaag       c.*20280

          .         .         .         .         .         .       g.83804
 tggagttggtatttatatggcatttgttccttttaaaatgtatttttaattgataaataa       c.*20340

          .         .         .         .         .         .       g.83864
 taattgtatatatttataatgtataatgaataaactgaaaaattcaatagaaagcttcaa       c.*20400

          .         .         .         .         .         .       g.83924
 cagtaggttcaattaagcagaagaaagaataagtgaactcaaagacaggacacttgaaat       c.*20460

          .         .         .         .         .         .       g.83984
 tatccagtcgaaggaacaaaaagaaaaaagaataaaagaagtctatgggatctatgggaa       c.*20520

          .         .         .         .         .         .       g.84044
 accatcaagagaactaatatttacataatgcaatttcagaaagagaagagagagataaag       c.*20580

          .         .         .         .         .         .       g.84104
 ggacacaaagcctatctaaagaaataatagctgaaaacgtcccaaatctgggaagtgata       c.*20640

          .         .         .         .         .         .       g.84164
 tcaatattcatgtacaagaagttgtatgcaggttcttttcactttgagaaacagaaggtg       c.*20700

          .         .         .         .         .         .       g.84224
 aaactcaaactggcttaagtaattttaaaaaaatgtattggttcaagtgacttaaaaacc       c.*20760

          .         .         .         .         .         .       g.84284
 acactggttccaggagcaggttgatagtacctcaaagatgtcaccatctcttggatgtgc       c.*20820

          .         .         .         .         .         .       g.84344
 tttccctgttcattcctaagcttcatgcagtttcagggtggtgaccagaagtttacatct       c.*20880

          .         .         .         .         .         .       g.84404
 tatcttccctctcccctgtgtttgactggaacagaaaaaagagtgtcttattccctagca       c.*20940

          .         .         .         .         .         .       g.84464
 ctttggacaaaagctctggacatgatggccatttgtgacagggaagtagaataccattat       c.*21000

          .         .         .         .         .         .       g.84524
 ttgaccagtctgggacatctgaattcagggctagagaacacagacaggggctaatggggt       c.*21060

          .         .         .         .         .         .       g.84584
 gcggggtagggggaaggaaaccccaaaataggaagctagattgctgttactggaagggga       c.*21120

          .         .         .         .         .         .       g.84644
 atgtgcacttcagcaagatgaaatcagtatgcaattcagctcccacatatgcagaactgt       c.*21180

          .         .         .         .         .         .       g.84704
 aaaaaagggagctgcatttggtttcttgggacctccacctggataaactgagttcggggg       c.*21240

          .         .         .         .         .         .       g.84764
 ttcagcatgcatctaacaagatgctcctattcccagcaaattttttcttggtgctccttg       c.*21300

          .         .         .         .         .         .       g.84824
 ctatctccttttgagctattttcatccactcagaacctggtctgttccctccattaccat       c.*21360

          .         .         .         .         .         .       g.84884
 atcttaggccacaggtgtattcatgacacccaggtgcccctcttcagagagatggagaga       c.*21420

          .         .         .         .         .         .       g.84944
 gtgggagcttttcaaaaggaatttgtactaaaaatggtaagtggcaatttgaaaaacaaa       c.*21480

          .         .         .         .         .         .       g.85004
 caaacgaatgaagcaaagtaacaaaaaatactgtactcaaaatgcttttaacaggacatg       c.*21540

          .         .         .         .         .         .       g.85064
 ttttatacagcatgtgctttaagccaaattaagtaaagcctagccacagattagatccca       c.*21600

          .         .         .         .         .         .       g.85124
 gaaggtgagactagcaggaggtatttaaaacacctgctagttctccctctttatcccata       c.*21660

          .         .         .         .         .         .       g.85184
 gatgggacactgaggcccaggaaagggaacaccttgacatcagcatcaatgtcaatgcca       c.*21720

          .         .         .         .         .         .       g.85244
 atgtcaatgtcagagctgggcctgagaccaacatcttctacttgcagacatgatgcctct       c.*21780

          .         .         .         .         .         .       g.85304
 gctgcgtcagtctcctaaagttatctttcacaaggtccactggtgttaaaacagctcatt       c.*21840

          .         .         .         .         .         .       g.85364
 ttttattttaaaagtatttttaagtaatctatatgaacaaataatgaattctcatgattc       c.*21900

          .         .         .         .         .         .       g.85424
 ccaaatgaaaaattaaacaaggaatagcatgcccccatttccctaccataggccacattt       c.*21960

          .         .         .         .         .         .       g.85484
 aaaaaattagtttcttgtgtattcttccagggatattttgtgtgtataaaaacaattcag       c.*22020

          .         .         .         .         .         .       g.85544
 tgacatactctcccgccattttaaatattatagcatactatacactctgctttgtacctt       c.*22080

          .         .         .         .         .         .       g.85604
 gcttatttcaaaatgtaaatcttggaaaatctttcatatgactctacaaacagtatcctc       c.*22140

          .         .         .         .         .         .       g.85664
 attcatttttacagctgtaaagtatctccttgcatgatgggaataacagtttatttagct       c.*22200

          .         .         .         .         .         .       g.85724
 ggttctctagtggtgtcaatttggttatttttgatactgtgctactgtaaacaatgctgc       c.*22260

          .         .         .         .         .         .       g.85784
 aatcaataactttatacacatgtcatttcatgtgattgtgattatatatgtaggaaaaat       c.*22320

          .         .         .         .         .         .       g.85844
 tccacaaaagtgaaatagcagaatactaagggcatatgcatttgttgttttgatagacgc       c.*22380

          .         .         .         .         .         .       g.85904
 tgaatggcccttcatgatgctcttgtcaatgtattctcctacaatgcggagagtgccttt       c.*22440

          .         .         .         .         .         .       g.85964
 ttcctcaggccctccccaacacagccagttactaatgttgtctttgagtgtttaatagtt       c.*22500

          .         .         .         .         .         .       g.86024
 gtgaggtggtatctcaatgttttaaaatttaaactacagaaataaaaaaaaaatactgga       c.*22560

                                                                    g.86025
 a                                                                  c.*22561

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The SH3 domain and tetratricopeptide repeats 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 20c
©2004-2017 Leiden University Medical Center