SH3 and multiple ankyrin repeat domains 2 (SHANK2) - 274 nt intron 18 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.627617
gtaagtcgcacacccggcccagccctgtacagtcaccatgccggtccctgagctgccctt  c.2278+60

         .         .         .         .         .         .  g.627677
tgcaaagcaccaggctgtgcatgaccccacgcttgctcgctacccccctcctgcccctgt  c.2278+120

         .         g.627694
acccagacgtgcatcag  c.2278+137

--------------------- middle of intron ---------------------
                               g.627695           .           g.627711
                               c.2279-137  gaaatgcccctgcatgc  c.2279-121

.         .         .         .         .         .           g.627771
cccgcagccccatgtgtgcacctccctcggagcctcgcggggcgttgttgctagtcctgc  c.2279-61

.         .         .         .         .         .           g.627831
ctttcctcttttctgtttatctaacattgttttgttttgaatttttgggcctctcactag  c.2279-1


Powered by LOVD v.3.0 Build 19a
©2004-2017 Leiden University Medical Center