SH3 and multiple ankyrin repeat domains 3 (SHANK3) - 621 nt intron 19 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.45753
gtaagggccacgggcggctgggagcgctgggtcgggcaggcatgggggtcagactgtcct  c.2265+60

         .         .         .         .         .         .  g.45813
gggccctcttgacggaggtgagagcctatcatgtggacccctctccagaggggtgtgtgc  c.2265+120

         .         .         .         .         .         .  g.45873
accccatggcctctctcagagactcttggggctgtctctgccccctaaatggccacagct  c.2265+180

         .         .         .         .         .         .  g.45933
cagcacctgctgggtttgctcttgtagcttttggtgcctctgccttcaggcagtccctgt  c.2265+240

         .         .         .         .         .         .  g.45993
ctcacgcctgagaccaccaaggtaccccagctccgctgagaacacgacaaagcatgtctc  c.2265+300

         .   g.46004
tgttccctgcc  c.2265+311

--------------------- middle of intron ---------------------
                                      g.46005     .           g.46014
                                      c.2266-310  cacttgccaa  c.2266-301

.         .         .         .         .         .           g.46074
cccggcgccttctaggctcctcccccaccctcacccagggtcggccagggtctgcaccca  c.2266-241

.         .         .         .         .         .           g.46134
ccctgcccaacaccgtctacactgtaccaccatctgcactgcccacacagcccaggctcc  c.2266-181

.         .         .         .         .         .           g.46194
aatgggctgcatcctctgctccctgagggcagagtccagacgtgattcctgggtccaggc  c.2266-121

.         .         .         .         .         .           g.46254
acccacaggcactagtgccattggagtgagagcgtggggtgtctcacctctggcttagga  c.2266-61

.         .         .         .         .         .           g.46314
ggaggactgggggcccccagtgccctggaacctccatattcccctccctgacccccacag  c.2266-1


Powered by LOVD v.3.0 Build 16
©2004-2016 Leiden University Medical Center