short stature homeobox (SHOX) - coding DNA reference sequence

(used for variant description)

(last modified September 25, 2015)

This file was created to facilitate the description of sequence variants on transcript NM_006883.2 in the SHOX gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009385.1, covering SHOX transcript NM_006883.2.

Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5031
                              cgcctgcttttgcccgggtcctgagaacagg       c.-661

 .         .         .         .         .         .                g.5091
 ggctccccacactttttttttttttggttttgttttatttcgtttccgcgcgtctctttc       c.-601

 .         .         .         .         .         .                g.5151
 tactgcaaacagaaatgggagggtggacaggcgggtaggagcggatcagacgcccaggac       c.-541

 .         .         .         .         .         .                g.5211
 gcagcagcccgagtccgcacagggtttgcgggaggtggtgaccgcgctggggacgccagg       c.-481

 .         .         .         .         .        | 02.             g.11134
 acgcgaatgaacctccggggcgcgctcggggcctgcgctcagagcttg | gaaaactggagt    c.-421

 .         .         .         .         .         .                g.11194
 ttgcttttcctccggccacggagagaacgcgggtaacctgtgtggggggctcgggcgcct       c.-361

 .         .         .         .         .         .                g.11254
 gcgcccccctcctgcgcgcgcgctctcccttccaaaaatgggatctttcccccttcgcac       c.-301

 .         .         .         .         .         .                g.11314
 caaggtgtacggacgccaaacagtgatgaaatgagaagaaagccaattgccggcctgggg       c.-241

 .         .         .         .         .         .                g.11374
 ggtgggggagacacagcgtctctgcgtgcgtccgccgcggagcccggagaccagtaattg       c.-181

 .         .         .         .         .         .                g.11434
 caccagacaggcagcgcatggggggctgggcgaggtcgccgcgtataaatagtgagattt       c.-121

 .         .         .         .         .         .                g.11494
 ccaatggaaaggcgtaaataacagcgctggtgatccacccgcgcgcacgggccgtcctct       c.-61

 .         .         .         .         .         .                g.11554
 ccgcgcggggagacgcgcgcatccaccagccccggctgctcgccagccccggccccagcc       c.-1

          .         .         .         .         .         .       g.11614
 M  E  E  L  T  A  F  V  S  K  S  F  D  Q  K  S  K  D  G  N         p.20

          .         .         .         .         .         .       g.11674
 G  G  G  G  G  G  G  G  K  K  D  S  I  T  Y  R  E  V  L  E         p.40

          .         .         .         .         .         .       g.11734
 S  G  L  A  R  S  R  E  L  G  T  S  D  S  S  L  Q  D  I  T         p.60

          .         .         .         .         .         .       g.11794
 E  G  G  G  H  C  P  V  H  L  F  K  D  H  V  D  N  D  K  E         p.80

          .         .         .        | 03.         .         .    g.15297
 K  L  K  E  F  G  T  A  R  V  A  E  G |   I  Y  E  C  K  E  K      p.100

          .         .         .         .         .         .       g.15357
 R  E  D  V  K  S  E  D  E  D  G  Q  T  K  L  K  Q  R  R  S         p.120

          .         .         .         .         .         .       g.15417
 R  T  N  F  T  L  E  Q  L  N  E  L  E  R  L  F  D  E  T  H         p.140

          .         .         .         .         .         .       g.15477
 Y  P  D  A  F  M  R  E  E  L  S  Q  R  L  G  L  S  E  A  R         p.160

        | 04 .         .         .         .         .         .    g.21531
 V  Q   | V  W  F  Q  N  R  R  A  K  C  R  K  Q  E  N  Q  M  H      p.180

      | 05   .         .         .         .         .         .    g.21711
 K  G |   V  I  L  G  T  A  N  H  L  D  A  C  R  V  A  P  Y  V      p.200

          .         .         .    | 06    .         .         .    g.39468
 N  M  G  A  L  R  M  P  F  Q  Q   | M  E  F  C  S  C  R  P  G      p.220

          .                                                         g.39486
 TGGAGTATAATGGCATGA                                                 c.678
 W  S  I  M  A  X                                                   p.225

          .         .         .         .         .         .       g.39546
 tctcgactcactgcaacctccgcctcccgagttcaagcgattctcctgcctcagcctccc       c.*60

          .         .         .         .         .         .       g.39606
 gagtagctgggattacaggtgcccaccaccatgtcaagataatgtttgtattttcagtag       c.*120

          .         .         .         .         .         .       g.39666
 agatggggtttgaccatgttggccaggctggtctcgaactcctgacctcaggtgatccac       c.*180

          .         .         .         .         .         .       g.39726
 ccgccttagcctcccaaagtgctgggatgacaggcgtgagcccctgcgcccggcctttgt       c.*240

          .         .         .         .         .         .       g.39786
 aactttatttttaattttttttttttttttaagaaagacagagtcttgctctgtcaccca       c.*300

          .         .         .         .         .         .       g.39846
 ggctggagcacactggtgcgatcatagctcactgcagcctcaaactcctgggctcaagca       c.*360

          .         .         .         .         .         .       g.39906
 atcctcccacctcagcctcctgagtagctgggactacaggcacccaccaccacacccagc       c.*420

          .         .         .         .         .         .       g.39966
 taatttttttgatttttactagagacgggatcttgctttgctgctgaggctggtcttgag       c.*480

          .         .         .         .         .         .       g.40026
 ctcctgagctccaaagatcctctcacctccacctcccaaagtgttagaattacaagcatg       c.*540

          .         .         .         .                           g.40068
 aaccactgcccgtggtctccaaaaaaaggactgttacgtgga                         c.*582

 (downstream sequence)
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Short stature homeobox protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center