sigma non-opioid intracellular receptor 1 (SIGMAR1) - coding DNA reference sequence

(used for variant description)

(last modified January 5, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_005866.2 in the SIGMAR1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_029945.1, covering SIGMAR1 transcript NM_005866.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5014
                                               ctccgaggccgtga       c.-61

 .         .         .         .         .         .                g.5074
 gcgcaaagcctcaggccccggctccctcctgagctgcgccgtgccaggccgcccgccggg       c.-1

          .         .         .         .         .         .       g.5134
 ATGCAGTGGGCCGTGGGCCGGCGGTGGGCGTGGGCCGCGCTGCTCCTGGCTGTCGCAGCG       c.60
 M  Q  W  A  V  G  R  R  W  A  W  A  A  L  L  L  A  V  A  A         p.20

          .         .         .         .         .         .       g.5194
 GTGCTGACCCAGGTCGTCTGGCTCTGGCTGGGTACGCAGAGCTTCGTCTTCCAGCGCGAA       c.120
 V  L  T  Q  V  V  W  L  W  L  G  T  Q  S  F  V  F  Q  R  E         p.40

          .         .         .  | 02      .         .         .    g.5380
 GAGATAGCGCAGTTGGCGCGGCAGTACGCTG | GGCTGGACCACGAGCTGGCCTTCTCTCGT    c.180
 E  I  A  Q  L  A  R  Q  Y  A  G |   L  D  H  E  L  A  F  S  R      p.60

          .         .         .         .         .         .       g.5440
 CTGATCGTGGAGCTGCGGCGGCTGCACCCAGGCCACGTGCTGCCCGACGAGGAGCTGCAG       c.240
 L  I  V  E  L  R  R  L  H  P  G  H  V  L  P  D  E  E  L  Q         p.80

          .         .         .         .         .         .       g.5500
 TGGGTGTTCGTGAATGCGGGTGGCTGGATGGGCGCCATGTGCCTTCTGCACGCCTCGCTG       c.300
 W  V  F  V  N  A  G  G  W  M  G  A  M  C  L  L  H  A  S  L         p.100

          .         .         .         .         .   | 03     .    g.5690
 TCCGAGTATGTGCTGCTCTTCGGCACCGCCTTGGGCTCCCGCGGCCACTCGG | GGCGCTAC    c.360
 S  E  Y  V  L  L  F  G  T  A  L  G  S  R  G  H  S  G |   R  Y      p.120

          .         .         .         .         .         .       g.5750
 TGGGCTGAGATCTCGGATACCATCATCTCTGGCACCTTCCACCAGTGGAGAGAGGGCACC       c.420
 W  A  E  I  S  D  T  I  I  S  G  T  F  H  Q  W  R  E  G  T         p.140

          .         .      | 04  .         .         .         .    g.6948
 ACCAAAAGTGAGGTCTTCTACCCAG | GGGAGACGGTAGTACACGGGCCTGGTGAGGCAACA    c.480
 T  K  S  E  V  F  Y  P  G |   E  T  V  V  H  G  P  G  E  A  T      p.160

          .         .         .         .         .         .       g.7008
 GCTGTGGAGTGGGGGCCAAACACATGGATGGTGGAGTACGGCCGGGGCGTCATCCCATCC       c.540
 A  V  E  W  G  P  N  T  W  M  V  E  Y  G  R  G  V  I  P  S         p.180

          .         .         .         .         .         .       g.7068
 ACCCTGGCCTTCGCGCTGGCCGACACTGTCTTCAGCACCCAGGACTTCCTCACCCTCTTC       c.600
 T  L  A  F  A  L  A  D  T  V  F  S  T  Q  D  F  L  T  L  F         p.200

          .         .         .         .         .         .       g.7128
 TATACTCTTCGCTCCTATGCTCGGGGCCTCCGGCTTGAGCTCACCACCTACCTCTTTGGC       c.660
 Y  T  L  R  S  Y  A  R  G  L  R  L  E  L  T  T  Y  L  F  G         p.220

          .                                                         g.7140
 CAGGACCCTTGA                                                       c.672
 Q  D  P  X                                                         p.223

          .         .         .         .         .         .       g.7200
 ccagccaggcctgaaggaagacctgcggatggacaggagcgggcaggcccgcacatatcc       c.*60

          .         .         .         .         .         .       g.7260
 acttgctggagcccatgtttacagacagggacatacaccatgcagatcctgagttcctgc       c.*120

          .         .         .         .         .         .       g.7320
 tgtatgagcagggatatccatgcttatgtatccaaacacagagacccatgggaacaaatg       c.*180

          .         .         .         .         .         .       g.7380
 agacacatatagatactgagacctgtgtgtacagtaggaccatgcactcacacccatctg       c.*240

          .         .         .         .         .         .       g.7440
 gagagggagcccccggtataccaagggagccagttgtgttcagacacacacatcacagct       c.*300

          .         .         .         .         .         .       g.7500
 tgactcactaactgaggcctttccatagctccacagcttcccacctcctccccaccaaac       c.*360

          .         .         .         .         .         .       g.7560
 cggggttctagagttaaggatgggggagggtattatactgcctcagtctgactcctcaac       c.*420

          .         .         .         .         .         .       g.7620
 ccagcagcaatttgaggggatgagggggaagaggagctgccttttggaggcccccttcac       c.*480

          .         .         .         .         .         .       g.7680
 ctgcagctatgatgcccttccccttctcccctgtcctcaccatatgccttatccccattc       c.*540

          .         .         .         .         .         .       g.7740
 tactcccctgctatgcaagtgcccctgtggcttgtccccaaccccctcagcaacaaagct       c.*600

          .         .         .         .         .         .       g.7800
 cagctggggaacgagagtaatttgaagaatgcttgaagtcagcgtcttccattccagaaa       c.*660

          .         .         .         .         .         .       g.7860
 gacccccattcttcctttgggggtatgatgtggaagctggtttcagcccaggacccacca       c.*720

          .         .         .         .         .         .       g.7920
 ctgaggagaggatctagacaggtgggcctaattccaaggggcccttcctggcctggagaa       c.*780

          .         .         .         .         .         .       g.7980
 ggccttttacacacacacaacacatacacacacacacacacacacacatatcacagtttt       c.*840

          .         .         .         .         .         .       g.8040
 cacacagcccctgctgcattctctgtccatctgtctgtttctattaataaagatttgttg       c.*900

                                                                    g.8049
 atctgttcc                                                          c.*909

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Sigma non-opioid intracellular receptor 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 18
©2004-2017 Leiden University Medical Center