solute carrier family 17 (anion/sugar transporter), member 5 (SLC17A5) - coding DNA reference sequence

(used for variant description)

(last modified August 30, 2012)


This file was created to facilitate the description of sequence variants on transcript NM_012434.4 in the SLC17A5 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000006.11, covering SLC17A5 transcript NM_012434.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5008
                                                     gtggccgc       c.-121

 .         .         .         .         .         .                g.5068
 ggggcggtgtcatcgcccccgccccgcccggtccagccagctcggcccgggggcttcggg       c.-61

 .         .         .         .         .         .                g.5128
 ctgtcgggccggcgctcccttctctgccaggtggcgagtacacctgctcacgtaggcgtc       c.-1

          .         .         .         .         .         .       g.5188
 ATGAGGTCTCCGGTTCGAGACCTGGCCCGGAACGATGGCGAGGAGAGCACGGACCGCACG       c.60
 M  R  S  P  V  R  D  L  A  R  N  D  G  E  E  S  T  D  R  T         p.20

          .         .         .     | 02   .         .         .    g.14437
 CCTCTTCTACCGGGCGCCCCACGGGCCGAAGCCG | CTCCAGTGTGCTGCTCTGCTCGTTAC    c.120
 P  L  L  P  G  A  P  R  A  E  A  A |   P  V  C  C  S  A  R  Y      p.40

          .         .         .         .         .         .       g.14497
 AACTTAGCAATTTTGGCCTTTTTTGGTTTCTTCATTGTGTATGCATTACGTGTGAATCTG       c.180
 N  L  A  I  L  A  F  F  G  F  F  I  V  Y  A  L  R  V  N  L         p.60

          .         .         .         .         .         .       g.14557
 AGTGTTGCGTTAGTGGATATGGTAGATTCAAATACAACTTTAGAAGATAATAGAACTTCC       c.240
 S  V  A  L  V  D  M  V  D  S  N  T  T  L  E  D  N  R  T  S         p.80

          .         .         .         .         .  | 03      .    g.17099
 AAGGCGTGTCCAGAGCATTCTGCTCCCATAAAAGTTCATCATAATCAAACG | GGTAAGAAG    c.300
 K  A  C  P  E  H  S  A  P  I  K  V  H  H  N  Q  T   | G  K  K      p.100

          .         .         .         .         .         .       g.17159
 TACCAATGGGATGCAGAAACTCAAGGATGGATTCTCGGTTCCTTTTTTTATGGCTACATC       c.360
 Y  Q  W  D  A  E  T  Q  G  W  I  L  G  S  F  F  Y  G  Y  I         p.120

          .         .         .         .         .         .       g.17219
 ATCACACAGATTCCTGGAGGATATGTTGCCAGCAAAATAGGGGGGAAAATGCTGCTAGGA       c.420
 I  T  Q  I  P  G  G  Y  V  A  S  K  I  G  G  K  M  L  L  G         p.140

          .         .         .         .         .         .       g.17279
 TTTGGGATCCTTGGCACTGCTGTCCTCACCCTGTTCACTCCCATTGCTGCAGATTTAGGA       c.480
 F  G  I  L  G  T  A  V  L  T  L  F  T  P  I  A  A  D  L  G         p.160

          .         .         .         .      | 04  .         .    g.20530
 GTTGGACCACTCATTGTACTCAGAGCACTAGAAGGACTAGGAGAG | GGTGTTACATTTCCA    c.540
 V  G  P  L  I  V  L  R  A  L  E  G  L  G  E   | G  V  T  F  P      p.180

          .         .         .         .         .         .       g.20590
 GCCATGCATGCCATGTGGTCTTCTTGGGCTCCCCCTCTTGAAAGAAGCAAACTTCTTAGC       c.600
 A  M  H  A  M  W  S  S  W  A  P  P  L  E  R  S  K  L  L  S         p.200

          .    | 05    .         .         .         .         .    g.22354
 ATTTCATATGCAG | GAGCACAGCTTGGGACAGTAATTTCTCTTCCTCTTTCTGGAATAATT    c.660
 I  S  Y  A  G |   A  Q  L  G  T  V  I  S  L  P  L  S  G  I  I      p.220

          .         .         .         . | 06       .         .    g.23534
 TGCTACTATATGAATTGGACTTATGTCTTCTACTTTTTTG | GTACTATTGGAATATTTTGG    c.720
 C  Y  Y  M  N  W  T  Y  V  F  Y  F  F  G |   T  I  G  I  F  W      p.240

          .         .         .         .         .         .       g.23594
 TTTCTTTTGTGGATCTGGTTAGTTAGTGACACACCACAAAAACACAAGAGAATTTCCCAT       c.780
 F  L  L  W  I  W  L  V  S  D  T  P  Q  K  H  K  R  I  S  H         p.260

          .         .         .          | 07        .         .    g.37073
 TATGAAAAGGAATACATTCTTTCATCATTAAGAAATCAG | CTTTCTTCACAGAAGTCAGTG    c.840
 Y  E  K  E  Y  I  L  S  S  L  R  N  Q   | L  S  S  Q  K  S  V      p.280

          .         .         .         .         .         .       g.37133
 CCGTGGGTACCCATTTTAAAATCCCTGCCACTTTGGGCTATCGTAGTTGCACACTTTTCT       c.900
 P  W  V  P  I  L  K  S  L  P  L  W  A  I  V  V  A  H  F  S         p.300

          .         .         .         .         .         .       g.37193
 TACAACTGGACTTTTTATACTTTATTGACATTATTGCCTACTTATATGAAGGAGATCCTA       c.960
 Y  N  W  T  F  Y  T  L  L  T  L  L  P  T  Y  M  K  E  I  L         p.320

          .         | 08         .         .         .         .    g.43609
 AGGTTCAATGTTCAAGAG | AATGGGTTTTTATCTTCATTGCCTTATTTAGGCTCTTGGTTA    c.1020
 R  F  N  V  Q  E   | N  G  F  L  S  S  L  P  Y  L  G  S  W  L      p.340

          .         .         .         .         .         .       g.43669
 TGTATGATCCTGTCTGGTCAAGCTGCTGACAATTTAAGGGCAAAATGGAATTTTTCAACT       c.1080
 C  M  I  L  S  G  Q  A  A  D  N  L  R  A  K  W  N  F  S  T         p.360

          .         .         .  | 09      .         .         .    g.48496
 TTATGTGTTCGCAGAATTTTTAGCCTTATAG | GAATGATTGGACCTGCAGTATTCCTGGTA    c.1140
 L  C  V  R  R  I  F  S  L  I  G |   M  I  G  P  A  V  F  L  V      p.380

          .         .         .         .         .         .       g.48556
 GCTGCTGGCTTCATTGGCTGTGATTATTCTTTGGCCGTTGCTTTCCTAACTATATCAACA       c.1200
 A  A  G  F  I  G  C  D  Y  S  L  A  V  A  F  L  T  I  S  T         p.400

          .         .         .         .         .          | 10    g.58574
 ACACTGGGAGGCTTTTGCTCTTCTGGATTTAGCATCAACCATCTGGATATTGCTCCTTC | G    c.1260
 T  L  G  G  F  C  S  S  G  F  S  I  N  H  L  D  I  A  P  S  |      p.420

          .         .         .         .         .         .       g.58634
 TATGCTGGTATCCTCCTGGGCATCACAAATACATTTGCCACTATTCCAGGAATGGTTGGG       c.1320
 Y  A  G  I  L  L  G  I  T  N  T  F  A  T  I  P  G  M  V  G         p.440

          .         .         . | 11       .         .         .    g.63830
 CCCGTCATTGCTAAAAGTCTGACCCCTGAT | AACACTGTTGGAGAATGGCAAACCGTGTTC    c.1380
 P  V  I  A  K  S  L  T  P  D   | N  T  V  G  E  W  Q  T  V  F      p.460

          .         .         .         .         .         .       g.63890
 TATATTGCTGCTGCTATTAATGTTTTTGGTGCCATTTTCTTTACACTATTCGCCAAAGGT       c.1440
 Y  I  A  A  A  I  N  V  F  G  A  I  F  F  T  L  F  A  K  G         p.480

          .         .         .         .                           g.63938
 GAAGTACAAAACTGGGCTCTCAATGATCACCATGGACACAGACACTGA                   c.1488
 E  V  Q  N  W  A  L  N  D  H  H  G  H  R  H  X                     p.495

          .         .         .         .         .         .       g.63998
 aggaaccaataaataatcctgcctctattaatgtatttttatttatcatgtaacctcaaa       c.*60

          .         .         .         .         .         .       g.64058
 gtgccttctgtattgtgtaagcattctatgtctttttttaattgtacttgtattagattt       c.*120

          .         .         .         .         .         .       g.64118
 ttaaggcctataatcatgaaatatcactagttgccagaataataaaatgaactgtgttta       c.*180

          .         .         .         .         .         .       g.64178
 attatgaataatatgtaagctaggacttctactttaggttcacatacctgcctgctagtc       c.*240

          .         .         .         .         .         .       g.64238
 gggcaacatgaagtaggacagttctgttgattttttagggccatactaaagggaatgagc       c.*300

          .         .         .         .         .         .       g.64298
 tgaaacagacctcctgatacctttgcttaattaaactagatgataattctcaggtactga       c.*360

          .         .         .         .         .         .       g.64358
 taaacacctgttgttgttcactttcctcataaaaattgtcagctctctctgacacttaga       c.*420

          .         .         .         .         .         .       g.64418
 cctcaaactttagcatctctgtggagctgccatccactgtataatttcgcctggcaactg       c.*480

          .         .         .         .         .         .       g.64478
 gactgaggggagtgtgcccaggcagctgccaagcactccctccctggcttcagggtcaga       c.*540

          .         .         .         .         .         .       g.64538
 gtgcccagcgtttatcagaggcagcatccaagcccagagccagtgtcgactcttcggctg       c.*600

          .         .         .         .         .         .       g.64598
 gtgcctttcctctgaggggctatcaatgtgtagataaagccctgagtaggcaagagcagt       c.*660

          .         .         .         .         .         .       g.64658
 gagatccactgctatggtcttgatacatcctcaaactttcccttcccagcacagaggaat       c.*720

          .         .         .         .         .         .       g.64718
 attggctggcatgcaacctgcaaaagaaaaatgcgaagcggccgggcacggtggctcatg       c.*780

          .         .         .         .         .         .       g.64778
 cctgtaatcccagcactttggggggctgaggtgggcgaatcatgagatcaggagttcgag       c.*840

          .         .         .         .         .         .       g.64838
 accagcctggccagcatggtgaaaccccatctctactaaaaatacaaaaaattagctggg       c.*900

          .         .         .         .         .         .       g.64898
 cgtggtgacgggcgcctgtaatcccagatactcaggaggctgaggtaggagaatcacttg       c.*960

          .         .         .         .         .         .       g.64958
 aacctgggaggtggaagttgcagtgaaccaagatcacgccactgcactccagcctgggcg       c.*1020

          .         .         .         .         .         .       g.65018
 atggagcgagactccaactcaaaaaaaaaaaaagaataaagaaagaaaagtgcgatgccc       c.*1080

          .         .         .         .         .         .       g.65078
 agtcaatcacaaataagatcatcctggtttaaatctactctcacatggatcacagtataa       c.*1140

          .         .         .         .         .         .       g.65138
 atttctatgtgctgtgttttgttcgtttgtattttgtagagatggggtctcgttttgtcg       c.*1200

          .         .         .         .         .         .       g.65198
 cccaggctggttttgaactcctggcttcaagcgatcctcctgtctcggcctcacaaagtg       c.*1260

          .         .         .         .         .         .       g.65258
 ttgagactacaggcatgagccactgtgcccagcctgttctatgtttttaagctacacgag       c.*1320

          .         .         .         .         .         .       g.65318
 aattttttttttaattaattctcactgtttgttcagtctgtcttcatctaagtttgtgtt       c.*1380

          .         .         .         .         .         .       g.65378
 gcagtttaaagttaaagtgacttttaaaggccacatcacctgagactagggtaatcatct       c.*1440

          .         .         .         .         .         .       g.65438
 ttacttctggttcctgaaatcatatttttccagtggaccatcctccagtggctgtggttg       c.*1500

          .         .         .         .         .         .       g.65498
 ttgagcatgctttcagaacacctatgtggcttaaaacttagtttatgttttgtgttcaac       c.*1560

          .         .         .         .         .         .       g.65558
 actacgtgtaatattttaaaactgtttaatgtgatgtgaatacatttatgtacatttatt       c.*1620

          .         .         .         .         .         .       g.65618
 tttaaatttgtaaatagctttaaattgctatggcaatgtttcttttataaatcatcaaaa       c.*1680

          .                                                         g.65636
 taaacctttgtgaattga                                                 c.*1698

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Solute carrier family 17 (anion/sugar transporter), member 5 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build beta-07
©2004-2012 Leiden University Medical Center