solute carrier family 37 (glucose-6-phosphate transporter), member 4 (SLC37A4) - coding DNA reference sequence

(used for variant description)

(last modified February 3, 2021)

This file was created to facilitate the description of sequence variants on transcript NM_001164277.1 in the SLC37A4 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_013331.1, covering SLC37A4 transcript NM_001164277.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5037
                        gcttgcgcagccttcgctagccccgccccgtcctatt       c.-721

 .         .         . | 02       .         .         .             g.5210
 cgggctcccgcctctgttcag | ttccagagacaattcatgggtcttggggccaccgaggcg    c.-661

 .         .         .         .         .         .                g.5270
 ctgtccctgaccaccagcacgagacccctttctatcgcgccagtcctgtggtctccgcac       c.-601

 .         .         .         .         .         .                g.5330
 ctctccagctcctgcacccccggcccccgtggttcccagccgcacagtagcgtgtcctgg       c.-541

 .         .         .         .         .         .                g.5390
 gtagcgtgaggacccacggggctgggcaggtgccacgagcccgccgcctcttcgccgccc       c.-481

 .         .         .         .         .         .                g.5450
 gccgcctctcctcctctcccgcccgccgcctggccctcccctaccaggctgagcctctgg       c.-421

 .         .         .         .         .         .                g.5510
 gtgccagaagcgcggggcctccgggagaatacgtgcggtcgcccgctccgcgtgcgccta       c.-361

 .         .         .         .         .         .                g.5570
 cgccttctgctccagttgctttcccaattgagcggaaaagccggggcatgttgccggggc       c.-301

 .         .         .         .         .         .                g.5630
 cctgggcgggacggttgtgccctgcagcccgaagcccgccggggcaccttcccgcccacg       c.-241

 .         .         .         .         .     | 03   .             g.6357
 agctgcccagtccctctgcttgcggcccctgccaacgtcccacag | gacactgggtcccct    c.-181

 .         .         .         .         .         .                g.6417
 tggagcctccccaggcttaatgattgtccagaaggcggctataaagggagcctgggaggc       c.-121

 .         .         .         .         .         .                g.6477
 tgggtggaggagggagcagaaaaaacccaactcagcagatctgggaactgtgagagcggc       c.-61

 .         .         .         .         .         .                g.6537
 aagcaggaactgtggtcagaggctgtgcgtcttggctggtagggcctgctcttttctacc       c.-1

          .         .         .         .         .         .       g.6597
 ATGGCAGCCCAGGGCTATGGCTATTATCGCACTGTGATCTTCTCAGCCATGTTTGGGGGC       c.60
 M  A  A  Q  G  Y  G  Y  Y  R  T  V  I  F  S  A  M  F  G  G         p.20

          .         .         .         .         .         .       g.6657
 TACAGCCTGTATTACTTCAATCGCAAGACCTTCTCCTTTGTCATGCCATCATTGGTGGAA       c.120
 Y  S  L  Y  Y  F  N  R  K  T  F  S  F  V  M  P  S  L  V  E         p.40

          .         .         | 04         .         .         .    g.7512
 GAGATCCCTTTGGACAAGGATGATTTGG | GGTTCATCACCAGCAGCCAGTCGGCAGCTTAT    c.180
 E  I  P  L  D  K  D  D  L  G |   F  I  T  S  S  Q  S  A  A  Y      p.60

          .         .         .         .         .         .       g.7572
 GCTATCAGCAAGTTTGTCAGTGGGGTGCTGTCTGACCAGATGAGTGCTCGCTGGCTCTTC       c.240
 A  I  S  K  F  V  S  G  V  L  S  D  Q  M  S  A  R  W  L  F         p.80

          .         .         .         .         .         .       g.7632
 TCTTCTGGGCTGCTCCTGGTTGGCCTGGTCAACATATTCTTTGCCTGGAGCTCCACAGTA       c.300
 S  S  G  L  L  L  V  G  L  V  N  I  F  F  A  W  S  S  T  V         p.100

          .         .         .         .         .         .       g.7692
 CCTGTCTTTGCTGCCCTCTGGTTCCTTAATGGCCTGGCCCAGGGGCTGGGCTGGCCCCCA       c.360
 P  V  F  A  A  L  W  F  L  N  G  L  A  Q  G  L  G  W  P  P         p.120

          .         .  | 05      .         .         .         .    g.8073
 TGTGGGAAGGTCCTGCGGAAG | TGGTTTGAGCCATCTCAGTTTGGCACTTGGTGGGCCATC    c.420
 C  G  K  V  L  R  K   | W  F  E  P  S  Q  F  G  T  W  W  A  I      p.140

          .         .         .         .         .         .       g.8133
 CTGTCAACCAGCATGAACCTGGCTGGAGGGCTGGGCCCTATCCTGGCAACCATCCTTGCC       c.480
 L  S  T  S  M  N  L  A  G  G  L  G  P  I  L  A  T  I  L  A         p.160

          .         .         .         .         .         .       g.8193
 CAGAGCTACAGCTGGCGCAGCACGCTGGCCCTATCTGGGGCACTGTGGTGTGGTTGTCTC       c.540
 Q  S  Y  S  W  R  S  T  L  A  L  S  G  A  L  W  C  G  C  L         p.180

          .         .         .                                     g.8223
 CTTCCTCTGTCTCCTGCTCATCCACAATGA                                     c.570
 L  P  L  S  P  A  H  P  Q  X                                       p.189

          .         .         .         .         .       | 06 .    g.8815
 acctgctgatgttggactccgcaacctggaccccatgccctctgagggcaagaagg | gctc    c.*60

          .         .         .         .         .         .       g.8875
 cttgaaggaggagagcaccctgcaggagctgctgctgtccccttacctgtgggtgctctc       c.*120

          .         .         .         .         .         .       g.8935
 cactggttaccttgtggtgtttggagtaaagacctgctgtactgactggggccagttctt       c.*180

          .         .         .      | 07  .         .         .    g.9243
 ccttatccaggagaaaggacagtcagcccttgtag | gtagctcctacatgagtgccctgga    c.*240

          .         .         .         .         .         .       g.9303
 agttgggggccttgtaggcagcatcgcagctggctacctgtcagaccgggccatggcaaa       c.*300

   | 08      .         .         .         .         .         .    g.9885
 g | gcgggactgtccaactacgggaaccctcgccatggcctgttgctgttcatgatggctgg    c.*360

          .         .         .         .         .      | 09  .    g.10582
 catgacagtgtccatgtacctcttccgggtaacagtgaccagtgactcccccaag | ctctg    c.*420

          .         .         .         .         .         .       g.10642
 gatcctggtattgggagctgtatttggtttctcctcgtatggccccattgccctgtttgg       c.*480

          .         .         .         .         .         .       g.10702
 agtcatagccaacgagagtgcccctcccaacttgtgtggcacctcccacgccattgtggg       c.*540

          .     | 10   .         .         .         .         .    g.10876
 actcatggccaatg | tgggcggctttctggctgggctgcccttcagcaccattgccaagca    c.*600

          .         .         .         .         .         .       g.10936
 ctacagttggagcacagccttctgggtggctgaagtgatttgtgcggccagcacggctgc       c.*660

          .         .         .         .         .         .       g.10996
 cttcttcctcctacgaaacatccgcaccaagatgggccgagtgtccaagaaggctgagtg       c.*720

          .         .         .         .         .         .       g.11056
 aagagagtccaggttccggagcaccatcccacggtggccttccccctgcacgctctgcgg       c.*780

          .         .         .         .         .         .       g.11116
 ggagaaaaggaggggcctgcctggctagccctgaacctttcactttccatttctgcgcct       c.*840

          .         .         .         .         .         .       g.11176
 tttctgtcacccgggtggcgctggaagttatcagtggctagtgaggtcccagctccctga       c.*900

          .         .         .         .         .         .       g.11236
 tcctatgctctatttaaaagataacctttggccttagactccgttagctcctatttcctg       c.*960

          .         .         .         .         .         .       g.11296
 ccttcagacaaacaggaaacttctgcagtcaggaaggctcctgtacccttcttcttttcc       c.*1020

          .         .         .         .         .         .       g.11356
 taggccctgtcctgcccgcatcctaccccatccccacctgaagtgaggctatccctgcag       c.*1080

          .         .         .         .         .         .       g.11416
 ctgcagggcactaatgacccttgacttctgctgggtcctaagtcctctcagcagtgggtg       c.*1140

          .         .         .         .         .         .       g.11476
 actgctgttgccaatacctcagactccagggaaagagaggaggccatcattctcactgta       c.*1200

          .         .         .         .         .         .       g.11536
 ccactaggcgcagttggatataggtgggaagaaaaggtgacttgttatagaagattaaaa       c.*1260

          .         .                                               g.11556
 ctagatttgatactgaacac                                               c.*1280

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Solute carrier family 37 (glucose-6-phosphate transporter), member 4 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.