solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 (SLC6A4) - coding DNA reference sequence

(used for variant description)

(last modified January 6, 2022)


This file was created to facilitate the description of sequence variants on transcript NM_001045.6 in the SLC6A4 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011747.2, covering SLC6A4 transcript NM_001045.6.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5244
                                                        acagc       c.-301

 .         .         .         .         .         .                g.5304
 cagcgccgccgggtgcctcgagggcgcgaggccagcccgcctgcccagcccgggaccagc       c.-241

 .         .          | 02        .         .         .             g.18061
 ctccccgcgcagcctggcag | gtctcctggaggcaaggcgaccttgcttgccctctcttgc    c.-181

 .         .         .         .         .         .       | 03     g.18858
 agaataacaaggggcttagccacaggagttgctggcaagtggaaagaagaacaaatg | agt    c.-121

 .         .         .         .         .         .                g.18918
 caatcccgacgtgtcaatcccgacgatagagagctcggaggtgatccacaaatccaagca       c.-61

 .         .         .         .         .         .                g.18978
 cccagagatcaattgggatccttggcagatggacatcagtgtcatttactaaccagcagg       c.-1

          .         .         .         .         .         .       g.19038
 ATGGAGACGACGCCCTTGAATTCTCAGAAGCAGCTATCAGCGTGTGAAGATGGAGAAGAT       c.60
 M  E  T  T  P  L  N  S  Q  K  Q  L  S  A  C  E  D  G  E  D         p.20

          .         .         .         .         .         .       g.19098
 TGTCAGGAAAACGGAGTTCTACAGAAGGTTGTTCCCACCCCAGGGGACAAAGTGGAGTCC       c.120
 C  Q  E  N  G  V  L  Q  K  V  V  P  T  P  G  D  K  V  E  S         p.40

          .         .         .         .         .         .       g.19158
 GGGCAAATATCCAATGGGTACTCAGCAGTTCCAAGTCCTGGTGCGGGAGATGACACACGG       c.180
 G  Q  I  S  N  G  Y  S  A  V  P  S  P  G  A  G  D  D  T  R         p.60

          .         .         .         .         .         .       g.19218
 CACTCTATCCCAGCGACCACCACCACCCTAGTGGCTGAGCTTCATCAAGGGGAACGGGAG       c.240
 H  S  I  P  A  T  T  T  T  L  V  A  E  L  H  Q  G  E  R  E         p.80

          .         .         .         .         .         .       g.19278
 ACCTGGGGCAAGAAGGTGGATTTCCTTCTCTCAGTGATTGGCTATGCTGTGGACCTGGGC       c.300
 T  W  G  K  K  V  D  F  L  L  S  V  I  G  Y  A  V  D  L  G         p.100

          .         .         .         .    | 04    .         .    g.22022
 AATGTCTGGCGCTTCCCCTACATATGTTACCAGAATGGAGGGG | GGGCATTCCTCCTCCCC    c.360
 N  V  W  R  F  P  Y  I  C  Y  Q  N  G  G  G |   A  F  L  L  P      p.120

          .         .         .         .         .         .       g.22082
 TACACCATCATGGCCATTTTTGGGGGAATCCCGCTCTTTTACATGGAGCTCGCACTGGGA       c.420
 Y  T  I  M  A  I  F  G  G  I  P  L  F  Y  M  E  L  A  L  G         p.140

          .         .         .         .         .         | 05    g.22601
 CAGTACCACCGAAATGGATGCATTTCAATATGGAGGAAAATCTGCCCGATTTTCAAAG | GG    c.480
 Q  Y  H  R  N  G  C  I  S  I  W  R  K  I  C  P  I  F  K  G |       p.160

          .         .         .         .         .         .       g.22661
 ATTGGTTATGCCATCTGCATCATTGCCTTTTACATTGCTTCCTACTACAACACCATCATG       c.540
 I  G  Y  A  I  C  I  I  A  F  Y  I  A  S  Y  Y  N  T  I  M         p.180

          .         .         .         .         .         .       g.22721
 GCCTGGGCGCTATACTACCTCATCTCCTCCTTCACGGACCAGCTGCCCTGGACCAGCTGC       c.600
 A  W  A  L  Y  Y  L  I  S  S  F  T  D  Q  L  P  W  T  S  C         p.200

          .         .         .         .         .         .       g.22781
 AAGAACTCCTGGAACACTGGCAACTGCACCAATTACTTCTCCGAGGACAACATCACCTGG       c.660
 K  N  S  W  N  T  G  N  C  T  N  Y  F  S  E  D  N  I  T  W         p.220

          .         .         .         | 06         .         .    g.23654
 ACCCTCCATTCCACGTCCCCTGCTGAAGAATTTTACAC | GCGCCACGTCCTGCAGATCCAC    c.720
 T  L  H  S  T  S  P  A  E  E  F  Y  T  |  R  H  V  L  Q  I  H      p.240

          .         .         .         .         .         .       g.23714
 CGGTCTAAGGGGCTCCAGGACCTGGGGGGCATCAGCTGGCAGCTGGCCCTCTGCATCATG       c.780
 R  S  K  G  L  Q  D  L  G  G  I  S  W  Q  L  A  L  C  I  M         p.260

          .         .         .         .         .        | 07.    g.24723
 CTGATCTTCACTGTTATCTACTTCAGCATCTGGAAAGGCGTCAAGACCTCTGGCAAG | GTG    c.840
 L  I  F  T  V  I  Y  F  S  I  W  K  G  V  K  T  S  G  K   | V      p.280

          .         .         .         .         .         .       g.24783
 GTGTGGGTGACAGCCACCTTCCCTTATATCATCCTTTCTGTCCTGCTGGTGAGGGGTGCC       c.900
 V  W  V  T  A  T  F  P  Y  I  I  L  S  V  L  L  V  R  G  A         p.300

          .         .         .         .         .         .       g.24843
 ACCCTCCCTGGAGCCTGGAGGGGTGTTCTCTTCTACTTGAAACCCAATTGGCAGAAACTC       c.960
 T  L  P  G  A  W  R  G  V  L  F  Y  L  K  P  N  W  Q  K  L         p.320

          .   | 08     .         .         .         .         .    g.25270
 CTGGAGACAGGG | GTGTGGATAGATGCAGCCGCTCAGATCTTCTTCTCTCTTGGTCCGGGC    c.1020
 L  E  T  G   | V  W  I  D  A  A  A  Q  I  F  F  S  L  G  P  G      p.340

          .         .         .         .         .       | 09 .    g.28073
 TTTGGGGTCCTGCTGGCTTTTGCTAGCTACAACAAGTTCAACAACAACTGCTACCA | AGAT    c.1080
 F  G  V  L  L  A  F  A  S  Y  N  K  F  N  N  N  C  Y  Q  |  D      p.360

          .         .         .         .         .         .       g.28133
 GCCCTGGTGACCAGCGTGGTGAACTGCATGACGAGCTTCGTTTCGGGATTTGTCATCTTC       c.1140
 A  L  V  T  S  V  V  N  C  M  T  S  F  V  S  G  F  V  I  F         p.380

          .         .         .         .         .         .       g.28193
 ACAGTGCTCGGTTACATGGCTGAGATGAGGAATGAAGATGTGTCTGAGGTGGCCAAAGAC       c.1200
 T  V  L  G  Y  M  A  E  M  R  N  E  D  V  S  E  V  A  K  D         p.400

      | 10   .         .         .         .         .         .    g.29568
 GCAG | GTCCCAGCCTCCTCTTCATCACGTATGCAGAAGCGATAGCCAACATGCCAGCGTCC    c.1260
 A  G |   P  S  L  L  F  I  T  Y  A  E  A  I  A  N  M  P  A  S      p.420

          .         .         .         .         .        | 11.    g.30293
 ACTTTCTTTGCCATCATCTTCTTTCTGATGTTAATCACGCTGGGCTTGGACAGCACG | TTT    c.1320
 T  F  F  A  I  I  F  F  L  M  L  I  T  L  G  L  D  S  T   | F      p.440

          .         .         .         .         .         .       g.30353
 GCAGGCTTGGAGGGGGTGATCACGGCTGTGCTGGATGAGTTCCCACACGTCTGGGCCAAG       c.1380
 A  G  L  E  G  V  I  T  A  V  L  D  E  F  P  H  V  W  A  K         p.460

          .         .         .         .         .         .       g.30413
 CGCCGGGAGCGGTTCGTGCTCGCCGTGGTCATCACCTGCTTCTTTGGATCCCTGGTCACC       c.1440
 R  R  E  R  F  V  L  A  V  V  I  T  C  F  F  G  S  L  V  T         p.480

           | 12        .         .         .         .         .    g.31745
 CTGACTTTT | GGAGGGGCCTACGTGGTGAAGCTGCTGGAGGAGTATGCCACGGGGCCCGCA    c.1500
 L  T  F   | G  G  A  Y  V  V  K  L  L  E  E  Y  A  T  G  P  A      p.500

          .         .         .         .          | 13        .    g.33115
 GTGCTCACTGTCGCGCTGATCGAAGCAGTCGCTGTGTCTTGGTTCTATG | GCATCACTCAG    c.1560
 V  L  T  V  A  L  I  E  A  V  A  V  S  W  F  Y  G |   I  T  Q      p.520

          .         .         .         .         .         .       g.33175
 TTCTGCAGGGACGTGAAGGAAATGCTCGGCTTCAGCCCGGGGTGGTTCTGGAGGATCTGC       c.1620
 F  C  R  D  V  K  E  M  L  G  F  S  P  G  W  F  W  R  I  C         p.540

          .         .         . | 14       .         .         .    g.37627
 TGGGTGGCCATCAGCCCTCTGTTTCTCCTG | TTCATCATTTGCAGTTTTCTGATGAGCCCG    c.1680
 W  V  A  I  S  P  L  F  L  L   | F  I  I  C  S  F  L  M  S  P      p.560

          .         .         .         .         .         .       g.37687
 CCACAACTACGACTTTTCCAATATAATTATCCTTACTGGAGTATCATCTTGGGTTACTGC       c.1740
 P  Q  L  R  L  F  Q  Y  N  Y  P  Y  W  S  I  I  L  G  Y  C         p.580

          .         .         .         .         .         .       g.37747
 ATAGGAACCTCATCTTTCATTTGCATCCCCACATATATAGCTTATCGGTTGATCATCACT       c.1800
 I  G  T  S  S  F  I  C  I  P  T  Y  I  A  Y  R  L  I  I  T         p.600

          .         | 15         .         .         .         .    g.42448
 CCAGGGACATTTAAAGAG | CGTATTATTAAAAGTATTACCCCAGAAACACCAACAGAAATT    c.1860
 P  G  T  F  K  E   | R  I  I  K  S  I  T  P  E  T  P  T  E  I      p.620

          .         .         .                                     g.42481
 CCTTGTGGGGACATCCGCTTGAATGCTGTGTAA                                  c.1893
 P  C  G  D  I  R  L  N  A  V  X                                    p.630

          .         .         .         .         .         .       g.42541
 cacactcaccgagaggaaaaaggcttctccacaacctcctcctccagttctgatgaggca       c.*60

          .         .         .         .         .         .       g.42601
 cgcctgccttctcccctccaagtgaatgagtttccagctaagcctgatgatggaagggcc       c.*120

          .         .         .         .         .         .       g.42661
 ttctccacagggacacagtctggtgcccagactcaaggcctccagccacttatttccatg       c.*180

          .         .         .         .         .         .       g.42721
 gattcccctggacatattcccatggtagactgtgacacagctgagctggcctattttgga       c.*240

          .         .         .         .         .         .       g.42781
 cgtgtgaggatgtggatggaggtgatgaaaaccaccctatcatcagttaggattaggttt       c.*300

          .         .         .         .         .         .       g.42841
 agaatcaagtctgtgaaagtctcctgtatcatttcttggtatgatcattggtatctgata       c.*360

          .         .         .         .         .         .       g.42901
 tctgtttgcttctaaaggtttcactgttcatgaatacgtaaactgcgtaggagagaacag       c.*420

          .         .         .         .         .         .       g.42961
 ggatgctatctcgctagccatatattttctgagtagcatatataattttattgctggaat       c.*480

          .         .         .         .         .         .       g.43021
 ctactagaaccttctaatccatgtgctgctgtggcatcaggaaaggaagatgtaagaagc       c.*540

          .         .         .         .         .         .       g.43081
 taaaatgaaaaatagtgtgtccatgcaagcttgtgagtctgtgtatattgttgtttcagt       c.*600

          .         .         .         .         .         .       g.43141
 gtattcttatctctagtccaatattttgggcccattacaaatatatgaattccccaaatt       c.*660

          .         .         .         .         .         .       g.43201
 tttcttacattaacaaattctaccaactcaattgtgtatggaggttattatttgaagggt       c.*720

          .         .         .         .         .         .       g.43261
 acaatcactacaacatgctctgccacccactccttttccagtgacactacttgagccaca       c.*780

          .         .         .         .         .         .       g.43321
 cactttcctttacaggccagcctctggcgtttgctgcacctcattgccaccttcctgtct       c.*840

          .         .         .         .         .         .       g.43381
 ctctgtgctaaacattcaggacagtgttccacaggcagatctggcctatttcattagtca       c.*900

          .         .         .         .         .         .       g.43441
 ccatggcttggctgtgaagtacgttgaaggtggatcttgtcacatgccccttcagtgttc       c.*960

          .         .         .         .         .         .       g.43501
 acctggccctctggtttaagttctgtctgccttacgtgactgagtttgactgtccaggtt       c.*1020

          .         .         .         .         .         .       g.43561
 gctttgctcggtgaagagaggagggtaaatcggattctcgtttagcactgggttatacag       c.*1080

          .         .         .         .         .         .       g.43621
 atctggcaccctaacctaaaccaaggcatcttcactccaagagcagttggagagtctggg       c.*1140

          .         .         .         .         .         .       g.43681
 ttagccttacgtggacctcgccgctcgctggcggtcacgattgtgagccctccagataat       c.*1200

          .         .         .         .         .         .       g.43741
 ttttaaggttgagtctaagtaaggctgcttgggaaatggtcagctaagtaaatcaccttt       c.*1260

          .         .         .         .         .         .       g.43801
 catttcacataaggcccttaatatagataagtaaatttggcctttggtgtctcgtgactc       c.*1320

          .         .         .         .         .         .       g.43861
 tcagaggcgtaggtagaggagcaaattaatatttgcagcatgggaattccttatcagaat       c.*1380

          .         .         .         .         .         .       g.43921
 tttgaggggaataaatcctcatcagagacaaaaggacttaatcatctggccacctatcac       c.*1440

          .         .         .         .         .         .       g.43981
 ttcagttctctgtataaatgaaatttaattctaacaaccttataaaaagaaggtccagac       c.*1500

          .         .         .         .         .         .       g.44041
 agcagaggaaacatcctgtccaattctaggttttcctcccttggcctcctttccccagca       c.*1560

          .         .         .         .         .         .       g.44101
 ttgtctaccctggcccacttcctgcattctccccatgccctgctatttctgattctttgc       c.*1620

          .         .         .         .         .         .       g.44161
 ttctcctagcgagatactttccttatatgatagctgctgagaagtttcccagaactgcta       c.*1680

          .         .         .         .         .         .       g.44221
 gaggaaaagaagtggggaatttaggaaatatccctcactgacctaactccattatcttca       c.*1740

          .         .         .         .         .         .       g.44281
 ctctttccttcttcctgccacctcatgcccattctctttactgtctagcatgctgaaaga       c.*1800

          .         .         .         .         .         .       g.44341
 aggaagtgatctaaatgccagcgtgttcagtggtaaatattagttggtgcaaaagaaaaa       c.*1860

          .         .         .         .         .         .       g.44401
 ccatgattacttttgcactaacctaatagctttgcaaattttaagaacttgctttatgaa       c.*1920

          .         .         .         .         .         .       g.44461
 gatattcggatatggattctccccaccccacatacttagacattgttcaaatatactact       c.*1980

          .         .         .         .         .         .       g.44521
 tttaaaaaaacaccttttcaaacagaattagcgttttgccaagtctggtattaatggaat       c.*2040

          .         .         .         .         .         .       g.44581
 tgtacaggagctttgaaagttttcaaactttattaaactaaaaaaaaaaaatcgaaaatc       c.*2100

          .         .         .         .         .         .       g.44641
 tctgtctgttccgcatagtatgcatttatttgacccctatttatcaatactatgatgggg       c.*2160

          .         .         .         .         .         .       g.44701
 ttttttttttttaaagaaaatttaagagtaggtaggtggattttaaaataatattttaaa       c.*2220

          .         .         .         .         .         .       g.44761
 gaccttttatatctatatgtagcatttatagaaaaataaaaactaaaaatagaattgaat       c.*2280

          .         .         .         .         .         .       g.44821
 tgtaacattatttaaggactgaagttttttttcttgtatcagtaagaaatacccaagagg       c.*2340

          .         .         .         .         .         .       g.44881
 ctgggtgcagtgactcacacctgtaatcccagcactttgggaggctgcagtgggaggatc       c.*2400

          .         .         .         .         .         .       g.44941
 acatgacatcaggagtttgagaccagcttggccaacatagtgaaacgccgtctctattaa       c.*2460

          .         .         .         .         .         .       g.45001
 aaatacagaaaattagctgaatgtggtggcaggcgcctataattcctgctacttgggagg       c.*2520

          .         .         .         .         .         .       g.45061
 ctgaggcaggagaattgcttgaacccaggaggcagaggttgcagtgagccaaacgttcca       c.*2580

          .         .         .         .         .         .       g.45121
 ctgcattccagcctggatgacaagagcgaaactccgtctcaaaaaaaaaaaaaaaaattg       c.*2640

          .         .         .         .         .         .       g.45181
 ttatgcttagttccatggaaagactattctgaagctttaagtcttctttttctattttcc       c.*2700

          .         .         .         .         .         .       g.45241
 atagtattgccccttccccacttcattgcttaactgtctctaaattttaatgataataat       c.*2760

          .         .         .         .         .         .       g.45301
 attttaaaggtcagataatgccattagaggcagagacaaacctggggaccaagctaattt       c.*2820

          .         .         .         .         .         .       g.45361
 ctctgttattgagagcgctaaagacaggtgaactggagttttatttcctctgctagagtg       c.*2880

          .         .         .         .         .         .       g.45421
 aaataataccctctccaccaggcacaatggctcacacctgtaattccagcactttgggag       c.*2940

          .         .         .         .         .         .       g.45481
 gccaaggtgggcggatcacttgaggtcaggagttcgagaccagcctggccaacatggtga       c.*3000

          .         .         .         .         .         .       g.45541
 aaccccatctctactaaaaatacaaaaattagccagccatggtggcatgctcctgtaatc       c.*3060

          .         .         .         .         .         .       g.45601
 ccagctacttgggagactgaggtgggataatcacttgaacctgggaggcggaggttgcag       c.*3120

          .         .         .         .         .         .       g.45661
 tgagctgagattgtgccactgcactccagcctgggtgacagagcaagactccatctaaaa       c.*3180

          .         .         .         .         .         .       g.45721
 aacaaaaacaaaaacaaaaaaaccctctcaattggtttaataccacgatagaaaagataa       c.*3240

          .         .         .         .         .         .       g.45781
 atattttaggatggaatcttaaatatgtctgtccttttgtttcatatagttgaaatcaat       c.*3300

          .         .         .         .         .         .       g.45841
 tcagtattgtttctacattaggtgtttcaaaaacagtcacctttgcaacagaagagctct       c.*3360

          .         .         .         .         .         .       g.45901
 tttgttgaaaatgattcacaatatatttcagttggaatgtcaggtggtatttctcttacc       c.*3420

          .         .         .         .         .         .       g.45961
 aacacctcacagaatctatgccaagctgctctaccaccaatgcaagtatttttttaaagc       c.*3480

          .         .         .         .         .         .       g.46021
 tactaaaataaactttcttcaccagccaactctaatttggagacagtgtgcattggtgaa       c.*3540

          .         .         .         .         .         .       g.46081
 ggacctcgtcagaataagtttgaatgtctactgaactaagaagaattttgtcgtttgggg       c.*3600

          .         .         .         .         .         .       g.46141
 gagagaatagatggcatcagtccttcaattctgtaactgaagactccaattatagtagat       c.*3660

          .         .         .         .         .         .       g.46201
 aagaattgtgtctagcaatttttaaacactgacagtccaaacaaaaatatttggtgagga       c.*3720

          .         .         .         .         .         .       g.46261
 aggatgtcccatatttttgcttaaatatcataaacaaatatgagcatttactaatttttt       c.*3780

          .         .         .         .         .         .       g.46321
 aaatggcattttgaaagattattcttatttacactctaaaattaaaggtgtactttatct       c.*3840

          .         .         .         .         .         .       g.46381
 taagaaaatgatatattaaaaattcatattttaaaagataaaattggggaatttacagtt       c.*3900

          .         .         .         .         .         .       g.46441
 attttgtgaatggcctttaaactatgatttgatctatatacaacttttcagaatactttt       c.*3960

          .         .         .         .         .         .       g.46501
 gattgtgtgttggacatatctaaaattaattttatctggcagaattaaacctaaatttat       c.*4020

          .         .         .         .         .         .       g.46561
 ttgtataaaagagtcccctttctaaaattcatacagtgcccttgtattcatttatgcagt       c.*4080

          .         .         .         .         .                 g.46618
 gtttataaatatttcaagttagattgtgagatattaataaatgatttatgctgtgaa          c.*4137

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 27
©2004-2022 Leiden University Medical Center