secreted LY6/PLAUR domain containing 1 (SLURP1) - coding DNA reference sequence

(used for variant description)

(last modified October 13, 2021)

This file was created to facilitate the description of sequence variants on transcript NM_020427.2 in the SLURP1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000008.10, covering SLURP1 transcript NM_020427.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5026
                                   ctctcatcacttctgagcacggagca       c.-1

          .         .         .         .         .         | 02    g.5491
 ATGGCCTCTCGCTGGGCTGTGCAGCTGCTGCTCGTGGCAGCCTGGAGCATGGGCTGTG | GT    c.60
 M  A  S  R  W  A  V  Q  L  L  L  V  A  A  W  S  M  G  C  G |       p.20

          .         .         .         .         .         .       g.5551
 GAGGCCCTCAAGTGCTACACCTGCAAGGAGCCCATGACCAGTGCTTCCTGCAGGACCATT       c.120
 E  A  L  K  C  Y  T  C  K  E  P  M  T  S  A  S  C  R  T  I         p.40

          .         .         .         .         .         | 03    g.6137
 ACCCGCTGCAAGCCAGAGGACACAGCCTGCATGACCACGCTGGTGACGGTGGAGGCAG | AG    c.180
 T  R  C  K  P  E  D  T  A  C  M  T  T  L  V  T  V  E  A  E |       p.60

          .         .         .         .         .         .       g.6197
 TACCCCTTCAACCAGAGCCCCGTGGTGACCCGCTCCTGCTCCAGCTCCTGTGTGGCCACC       c.240
 Y  P  F  N  Q  S  P  V  V  T  R  S  C  S  S  S  C  V  A  T         p.80

          .         .         .         .         .         .       g.6257
 GACCCCGACAGCATCGGGGCCGCCCACCTGATCTTCTGCTGCTTCCGAGACCTCTGCAAC       c.300
 D  P  D  S  I  G  A  A  H  L  I  F  C  C  F  R  D  L  C  N         p.100

          .                                                         g.6269
 TCGGAACTCTGA                                                       c.312
 S  E  L  X                                                         p.103

          .         .         .         .         .         .       g.6329
 acccagggcggcagggcggaaggtgctcctcaggcacctcctctctgacggggcctggct       c.*60

          .         .         .         .         .         .       g.6389
 ccacctgtgatcacctccccctgcttcctgctgctgtggcacagctcactcatggggtct       c.*120

          .         .         .         .         .         .       g.6449
 gaggggagagaagcacaccaggggcgccctctgccttccataccccacgcttataaaaca       c.*180

          .                                                         g.6468
 taactaagccaagagtgga                                                c.*199

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Secreted LY6/PLAUR domain containing 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.