SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2) - 13582 nt intron 01 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5123
gtaaatataacttacaactcttttctcctctttcccctcccttcggccgccccgctgcag  c.-37+60

         .         .         .         .         .         .  g.5183
ccgccgctcagacccctccggcaccacgccgccttcgcccgggattatccattattatcc  c.-37+120

         .         .         .         .         .         .  g.5243
taattattatttattgtgcatgcaaggagaccaaaacaaacaggcgggccaaccgccgcg  c.-37+180

         .         .         .         .         .         .  g.5303
acaaaaaaaagcccgcctcctccccgcgggcctcaggtggaatgctctaacgacagctcc  c.-37+240

         .         .         .         .         .         .  g.5363
caggcggcggtggaagaaacgagaaagtttcaaccgaaccttgctgttctaataataaca  c.-37+300

         .         .         .         .         .         .  g.5423
gtaataattactacttcaagggggcaaaggaggaaaaaaatcccaacaagccacagcctt  c.-37+360

         .         .         .         .         .         .  g.5483
gatcctgagtgggcagtcagaggcgctgccaactcaaggttgcaacacacacattgggcc  c.-37+420

         .         .         .         .         .         .  g.5543
aggttgcaatccccccatccccttaaaagtgaggcggcggggaggggggtggccgcagga  c.-37+480

         .         .         .         .         .         .  g.5603
gggggaaggcctgggggacaggggaggaggatggaaacgctactgttcatcccgggcaac  c.-37+540

         .         .         .         .         .         .  g.5663
cctccccggaagagttggaaggggaacgggaaaggagggcggggagcccaggctggcggc  c.-37+600

         .         .         .         .         .         .  g.5723
ggggcgccaacggacgctgttgccacccgcttcccagggacttgttcaaagggctccggc  c.-37+660

         .         .         .         .         .         .  g.5783
tgcggagacgtgagcggatcgcagcgggagaagcctgagctgacgcgcgaaggaggtagc  c.-37+720

         .         .         .         .         .         .  g.5843
ggccactgccgcggggccggtgcgtgcctgatcggaggtgtcacctccactttccgcgtt  c.-37+780

         .         .         .         .         .         .  g.5903
tcctccggcgtggatggggaggctgattggtaggcaggcctttaggcaaaggggctgcca  c.-37+840

         .         .         .         .         .         .  g.5963
gggggctgcgccccgggcgctgcggacgtccctgcctctggtacctggcggcagcgcagg  c.-37+900

         .         .         .         .         .         .  g.6023
ctcgggtgttaaagttcgggatgtccggcccgggccgcactgctggagggaagggaggag  c.-37+960

         .         .         .         .         .         .  g.6083
gcccccaaggaggtcggaggtgcccgccagcctccgttaccctgccctccctctccccgg  c.-37+1020

         .         .         .         .         .         .  g.6143
gtccgtgttcttttgcttcgcgtcttccccttgcttgcgccgcgggagctgcgggcgtgg  c.-37+1080

         .         .         .         .         .         .  g.6203
ggcgcctgcgatcgtccgggtgctaggggcgcgccgggacccaggagagccacggcggcg  c.-37+1140

         .         .         .         .         .         .  g.6263
gctgcgggcccgggaggccatgatccggataatcctgtctgcctgactgtcacaaacagg  c.-37+1200

         .         .         .         .         .         .  g.6323
acccgcgcaccaccgggcagcggcggtgtggttcgcccgggaaggggaagggctgcggtg  c.-37+1260

         .         .         .         .         .         .  g.6383
gggagggaataggggggtggcgagggcgggaggcggggagaccgggtaggagcctcctcc  c.-37+1320

         .         .         .         .         .         .  g.6443
caacgatgacacgcactccttccttctcgctccctgctcaggagtttgctttattcccat  c.-37+1380

         .         .         .         .         .         .  g.6503
cccaacctggtttaccccttcctttgctctccccctccacccggccgtcttcccttcctc  c.-37+1440

         .         .         .         .         .         .  g.6563
ccgtttgcgttgcaaaacacggccatgccatctgcaaaggtgtcgcgatgcacttcccta  c.-37+1500

         .         .         .         .         .         .  g.6623
aataaccggtccggcgcgccagcccctcggcgccctccggccgcagggcgcacacggagc  c.-37+1560

         .         .         .         .         .         .  g.6683
acagtgctcccggtgccccgcaccaggcctcgcagcctgggtgcagttacacggcggagg  c.-37+1620

         .         .         .         .         .         .  g.6743
gcggggcgcggcagtgcgggctccggcggacacccgcgccttggccggggcacttgggcc  c.-37+1680

         .         .         .         .         .         .  g.6803
ggtttccggtacacgcggggaaatcgcctcctgccagtgtctgatcgctcgcctccgcct  c.-37+1740

         .         .         .         .         .         .  g.6863
ccgcctctgccgcctggattgcattattatttttatccgggttgccgtttgctgcggatg  c.-37+1800

         .         .         .         .         .         .  g.6923
gtggtgagcgcggggctggctgggctgcttggggggtggggtggagggaagttggacgtg  c.-37+1860

         .         .         .         .         .         .  g.6983
gatcaggcaggaaaaaaaaagtttggcagggcggctaagtagggtggaggggtgggaggg  c.-37+1920

         .         .         .         .         .         .  g.7043
ggctgcgagctcccgcggctccagcctccgcgccctcccggccggcgcgagtgtgtctgc  c.-37+1980

         .         .         .         .         .         .  g.7103
gcgtgagtgtgagtgtgagtgtgtgttgtgcgcgcaggagccagtgcgtcgggagcagcg  c.-37+2040

         .         .         .         .         .         .  g.7163
gctcgggcagctgctcctgcccgcaccctcccctggagcccggggaggacaaggcgaggt  c.-37+2100

         .         .         .         .         .         .  g.7223
ttggtggcgagggctggtgggggtggcgtgtgcgtgtggttgtgagtgtgtgtgtgtgcg  c.-37+2160

         .         .         .         .         .         .  g.7283
cgcgcgagcggcggagaatcaggaagtcacagcagcgaagcgcacacagcacacagacat  c.-37+2220

         .         .         .         .         .         .  g.7343
gtttgattgccgtgacatgacgcgcgcgagggaggaagcggcagcggcgggggccgggcc  c.-37+2280

         .         .         .         .         .         .  g.7403
gcgggctgtggcgcgggcctagagccgcggctcggagaccggttcccgtccgccggccgc  c.-37+2340

         .         .         .         .         .         .  g.7463
gccgccaccccaagctccgcgaaccccgcgcccctttttgttccgcgtcctccaggtaag  c.-37+2400

         .         .         .         .         .         .  g.7523
gagcctgcgcagccctgccgccggctgtgtgcggagctttccagttctttccctgccagc  c.-37+2460

         .         .         .         .         .         .  g.7583
cccctccggtctcccggctcgcctttcctgcaaagtcaggcaggcgggggaaatgggctc  c.-37+2520

         .         .         .         .         .         .  g.7643
cttgtcctccgatcgattgcgtggaaaactttccagcgggaggcaccatgagggggaaga  c.-37+2580

         .         .         .         .         .         .  g.7703
aggccttgctggccgctgttgcttgtcagttctttctcctccgggtccggagagtgtgag  c.-37+2640

         .         .         .         .         .         .  g.7763
tcgctgcgcccggggctgttgcacattcaaacttcgggcctaaacgtacctccaactctc  c.-37+2700

         .         .         .         .         .         .  g.7823
gcaggttttactccagcaataaaataaatattcaaagtcgtccactagctcttgctaggc  c.-37+2760

         .         .         .         .         .         .  g.7883
gtttggattttttaagggaatgaggaaggcttgggaatcgagggagtgggggtgttgtgc  c.-37+2820

         .         .         .         .         .         .  g.7943
agaatccattccttattcaatgtctgcaccgggtgttatgtaattttagtggcacatggg  c.-37+2880

         .         .         .         .         .         .  g.8003
tgcaaagcctagactgggcttctcccctcctttgtttatataacttttgggtgagttttg  c.-37+2940

         .         .         .         .         .         .  g.8063
caaggttgtctcttttttttcctcctccctaacctgatggaggttggtgctttggaaaaa  c.-37+3000

         .         .         .         .         .         .  g.8123
gcaaagcgacctgggctagtaatcttttggagaggtgtcatcattgtctcctttctggtc  c.-37+3060

         .         .         .         .         .         .  g.8183
attatgtaggcatgtatgactttgtatgtgtactgttagagctcaaggaagacattaagg  c.-37+3120

         .         .         .         .         .         .  g.8243
atacacagtttgttgactgcactgagcggttatttttaacatttctgcgttaccaatatc  c.-37+3180

         .         .         .         .         .         .  g.8303
gaatttcaaacttccatttcaaaggacttaaaatttacacctggttgtgtgccttgcttg  c.-37+3240

         .         .         .         .         .         .  g.8363
tctgaacagaatgcttgcataaataatgagattgttgcttgggcgttgagtagcagaaaa  c.-37+3300

         .         .         .         .         .         .  g.8423
tttctatccaaccaccaaagactcagaaaccattgagaaccctaataataatttaaaaag  c.-37+3360

         .         .         .         .         .         .  g.8483
ccatacccaatgttatgtgtgtgtatacttacatattcacattcaaatattttcagtagt  c.-37+3420

         .         .         .         .         .         .  g.8543
attttccatctgttatcaggggggccacaaccagaagcttgttggccagcattggagttt  c.-37+3480

         .         .         .         .         .         .  g.8603
taggcttccaggctacctctagcacactggtgaagtgttaagaggcgtggcagatttgaa  c.-37+3540

         .         .         .         .         .         .  g.8663
tcctagttgctgcattgttatgcaaaatgagacacactttttctttgaggaatctaattg  c.-37+3600

         .         .         .         .         .         .  g.8723
ctcttttattctcttggactttctttctttttttcctcaaatgcttctttacaatgcaaa  c.-37+3660

         .         .         .         .         .         .  g.8783
tgtttgctattgtaaagaggggatttagagacacctgttaggtccaaaagatacttattg  c.-37+3720

         .         .         .         .         .         .  g.8843
cggtagactgaggggaaaaaaaaaaacaacccagtagatcagaggtccgtctaccttggg  c.-37+3780

         .         .         .         .         .         .  g.8903
ggcatcagagagatgccatttttgtaaagaacatttcaaatgaatgaggaatgtggggta  c.-37+3840

         .         .         .         .         .         .  g.8963
tcagaacccttgaagagggtgaggggagggagggcttccttcaatgcagcctttctctta  c.-37+3900

         .         .         .         .         .         .  g.9023
tgacttatatcagtaacagcccagcatcaggactaggtgcactgtggtgtttcacagaaa  c.-37+3960

         .         .         .         .         .         .  g.9083
atattcaccacaagagcatgttcaaagcagccttagatcttttcttttgttcgtttgtaa  c.-37+4020

         .         .         .         .         .         .  g.9143
agtggtttttgagcatttctcgtcaagtttcttgaaaagtgctttgaccaacacctgagg  c.-37+4080

         .         .         .         .         .         .  g.9203
cttagaattgacaaaaaaaaaaaaaaaaaagtgcctcggcttgtattatattgttaatgc  c.-37+4140

         .         .         .         .         .         .  g.9263
ttgaattctatttaaagtattcctgacatggtataactagaaagtgacacttgtgcagat  c.-37+4200

         .         .         .         .         .         .  g.9323
aagtatttaaaatttttttcttttattaagtttaagataaatcattctacaggccagtat  c.-37+4260

         .         .         .         .         .         .  g.9383
aaaagcatatcacatccttttctaaaaggtaattgtgatgctccttatattgttgtaata  c.-37+4320

         .         .         .         .         .         .  g.9443
ttttgacatttattattatgtattacagcaagagcataaaaagaagagttttataaatta  c.-37+4380

         .         .         .         .         .         .  g.9503
taaaagtggtgctgtcctccagtgttttcttgttttttttttttctcctttagaaatctt  c.-37+4440

         .         .         .         .         .         .  g.9563
cctttgtaaacaaggcctttgtcaaactcttctaggtcagcagctttttgataccccaga  c.-37+4500

         .         .         .         .         .         .  g.9623
gaaataataaatcactatttatgacatcttgacatggtgccatgaggacaactgaattat  c.-37+4560

         .         .         .         .         .         .  g.9683
cacatatgtaatactaaggactgtttcccagcatttgcaagtggaaggagtgttggtagg  c.-37+4620

         .         .         .         .         .         .  g.9743
acctgatttaaccactttaagatttgattctgtttctggtcaagatgatttaagggacga  c.-37+4680

         .         .         .         .         .         .  g.9803
tagggacaaattctttggttaacttgagttaccttagaaaactatatgagttacatttct  c.-37+4740

         .         .         .         .         .         .  g.9863
tttctgctgtatttcttgtgaacagatgagaaaatttccctagtatgaaagccacattta  c.-37+4800

         .         .         .         .         .         .  g.9923
ggggctatttctgatttctcctttttaatgtaaaagaattatcttctaaattgttttttt  c.-37+4860

         .         .         .         .         .         .  g.9983
ttcccccttaaatattgtgttttggagatgtctttggccaatagaggatgtgaattttct  c.-37+4920

         .         .         .         .         .         .  g.10043
gtcatttttggaagcgttcttattaggggactctaacctttagccggttaataaagccat  c.-37+4980

         .         .         .         .         .         .  g.10103
gggtcattcgctaagtagtgaatagaaaatacacatggtggtaatttatttgatagcata  c.-37+5040

         .         .         .         .         .         .  g.10163
tttaggaaggcctggagtgattattttttctatatagaaacttatgactttatacttact  c.-37+5100

         .         .         .         .         .         .  g.10223
agggactataggagtctaaaactatgttctgccagagtcattatgaaagagagcatattt  c.-37+5160

         .         .         .         .         .         .  g.10283
atttacgtaagatatttatcattaagttaaatgggatcttgcaacctgggctggcaaaac  c.-37+5220

         .         .         .         .         .         .  g.10343
tgcagctttcttactgtttattatgagtttattattacccatgttaatatagcacttttc  c.-37+5280

         .         .         .         .         .         .  g.10403
cttgaaagtgtaggatatgttaaagagagcttttaagtagtaaaagttataaatatatcg  c.-37+5340

         .         .         .         .         .         .  g.10463
tcaaagatgcttgaataattgtacctcagaaaaacatacaatagagccaatgaaattcag  c.-37+5400

         .         .         .         .         .         .  g.10523
gaacaaaatagctggtcttttgaatgtttgatataaacacctcattaatttacacatttg  c.-37+5460

         .         .         .         .         .         .  g.10583
gagtgatggtttagatatggaatacaagattttggcctgaaactctgacataatgtcctt  c.-37+5520

         .         .         .         .         .         .  g.10643
ctggacttctgggtttgtaatacattattatataattgaagcctagtatgaattaggata  c.-37+5580

         .         .         .         .         .         .  g.10703
ttttattagatagctacgacttccagaatatttgaacaattgtaatctggccgtatacct  c.-37+5640

         .         .         .         .         .         .  g.10763
gtaagatttacaacagtttttaaaaccacaatattctatagtatttttaggtggattagt  c.-37+5700

         .         .         .         .         .         .  g.10823
atcaatttaagcatcaatcttatgccagtatgtcatctacatctatgcaagcagtaatat  c.-37+5760

         .         .         .         .         .         .  g.10883
tttagaaactttttagaaactggcctaatttaaatatgggctggcccttttgtaagttga  c.-37+5820

         .         .         .         .         .         .  g.10943
tgaatgggacccacagaagttgaaataatatttaaagtttgaaaaccattaaatataatt  c.-37+5880

         .         .         .         .         .         .  g.11003
gaaactccctcctttaaaaaaaacaaaaacaactaaactcagaatttggaattcaaaatt  c.-37+5940

         .         .         .         .         .         .  g.11063
acttaaaaatgataaaaatctctaaccaaaaaggaacgtcatatgttggcttacaggtta  c.-37+6000

         .         .         .         .         .         .  g.11123
tccaagggaaattctgtatcagtttgcacttaaactgtatttttctggttcaggatgatt  c.-37+6060

         .         .         .         .         .         .  g.11183
atatatttctttacctacttgatgtggtatatttcagtttttaccatcccactgggagat  c.-37+6120

         .         .         .         .         .         .  g.11243
gctttatcacacatggatattggatgtccagaaggaaagccctctcccatcttcccccct  c.-37+6180

         .         .         .         .         .         .  g.11303
gtgctttgttgaactggacatgtaataaatggctttgcaaatagtcacaattattttgtg  c.-37+6240

         .         .         .         .         .         .  g.11363
gcttgctgttgtgctatactaaaagaccattaagcagagtccaaaattctgtaaaaaata  c.-37+6300

         .         .         .         .         .         .  g.11423
gatgatctgtaattgataatttatgtgtcttaaagaatgtacctgaacatttaatattgt  c.-37+6360

         .         .         .         .         .         .  g.11483
atttataatagcatattgaatacaagtaacaaatggtaaactgcatgggccatgtgatac  c.-37+6420

         .         .         .         .         .         .  g.11543
agagagagagatcagggtgagctttcttgagctgatggggtagataaggtctttgagatg  c.-37+6480

         .         .         .         .         .         .  g.11603
ggataaggttgctgtagggggagggcagaggtgggggtggtggcatctgagcatcccaga  c.-37+6540

         .         .         .         .         .         .  g.11663
tcagaagaaagccccgagatcacagagacccggcgagatcacagagacccggcctgaagg  c.-37+6600

         .         .         .         .         .         .  g.11723
aacgtggaaagaccaatgtacctgttttgaccggttgcctggagcaagaagttccagttg  c.-37+6660

         .         .         .         .         .         .  g.11783
gggagaattttcagaagataaagtcggagattgtggaaagacttgacttgcaggttaaag  c.-37+6720

         .         .         .         .         .         .  g.11843
catgaatattttatccaatctgtattggaggcttgtctcagaagttttgaacaagggaat  c.-37+6780

         .   g.11854
acatgaacaaa  c.-37+6791

--------------------- middle of intron ---------------------
                                     g.11855      .           g.11865
                                     c.-36-6791  gcaatatttta  c.-36-6781

.         .         .         .         .         .           g.11925
gattaatctggcaaattgtggattcaagtccagagtgggaattgaagctgttagaaggat  c.-36-6721

.         .         .         .         .         .           g.11985
cctggcaataatgcgagcatatagtagctcacaaggtgtcttcatatctcatattttatt  c.-36-6661

.         .         .         .         .         .           g.12045
tgattcgtatcaaaattgaagttgtagtcagctactgttatgcctattttgtaggtaagg  c.-36-6601

.         .         .         .         .         .           g.12105
agcttgaaactcagagaggttaaatgaactcatttgttgattttttaaaaggcatagtaa  c.-36-6541

.         .         .         .         .         .           g.12165
catcattaatggctattatccattttaactgcaatgaacttggagttcattgttgaattg  c.-36-6481

.         .         .         .         .         .           g.12225
ttgttgctactgtgaaagtcagggccagttgacattaatgagtgcctatgatagaacttt  c.-36-6421

.         .         .         .         .         .           g.12285
agttcattcagcatatgatggttgagttttactcttcagtaaaaatgtgccattttaacc  c.-36-6361

.         .         .         .         .         .           g.12345
acaggtttttaaagtatgtatttcagactcttctttttatatgtttaaagtataaataaa  c.-36-6301

.         .         .         .         .         .           g.12405
cttatcttggcagtcagaaaaggaagtggctgttgttgattcttatcaacatccagaatg  c.-36-6241

.         .         .         .         .         .           g.12465
aggttgctttgcaaaagggcctaacctaggagagacaggcatatgtgtaaatatacgtga  c.-36-6181

.         .         .         .         .         .           g.12525
catattacctttcagggtgtcatgatttgaaactaacttttttttgttcagtttgttagc  c.-36-6121

.         .         .         .         .         .           g.12585
ttttgttttgaccagtttgcccagccctttgggttccactgaattttaaaagtgattttc  c.-36-6061

.         .         .         .         .         .           g.12645
atctgtgattacctttataactactaatggacatgagtctcagagtagaggatgctttgc  c.-36-6001

.         .         .         .         .         .           g.12705
tctaaagggtttctaacacttaggttttctcgtaaattccctttttaaaacaatttttcc  c.-36-5941

.         .         .         .         .         .           g.12765
tttgtgggatcactgtcagtcctcatggaagaggccatgaaattgcatcgctggtagact  c.-36-5881

.         .         .         .         .         .           g.12825
cttttgagatggcaactcatggtatctataagggtggtaatgttaagagccaggatccta  c.-36-5821

.         .         .         .         .         .           g.12885
ttaaggcagtgtctgaggttcatgggggactaattagctgctgccgagtttgttgttatc  c.-36-5761

.         .         .         .         .         .           g.12945
ttttgttgtgcacagagctgcctcacagcctttgccaggtctgactctgggcaaggacca  c.-36-5701

.         .         .         .         .         .           g.13005
ttcccaaggcagtttatttaaagtgagggtagcagctcacccacatcctaatttgttgcc  c.-36-5641

.         .         .         .         .         .           g.13065
ctgattgaaagatgaaggagagttcacagaagcccaaggaacagagcaaagttttaatct  c.-36-5581

.         .         .         .         .         .           g.13125
aacaacttttaaaaaacatatttgactttgaaacgaatgggaaagtgttgtgaataaccc  c.-36-5521

.         .         .         .         .         .           g.13185
caagaatgctgaagaaatgttctcagtgattttctagggtcttgatggagcaacttataa  c.-36-5461

.         .         .         .         .         .           g.13245
ggttaactttagaacccggtgtgatttgtatctgacagatcacattatgcattgtttaaa  c.-36-5401

.         .         .         .         .         .           g.13305
gttgcacagctcagaccaagaagcagtgtgggccttggtaatgtttcaccgcttatcccg  c.-36-5341

.         .         .         .         .         .           g.13365
acaaccttggcctgtaaaaaggaaacttcgggtagatttatttcctttatctgcattgct  c.-36-5281

.         .         .         .         .         .           g.13425
gttctccttacccaccccgcactgcttccccattaagaataacagtgcttgaggcccagt  c.-36-5221

.         .         .         .         .         .           g.13485
tctgaagatgttgctacttcttgtgggtgaattatcaattcatttacagagaaagccaca  c.-36-5161

.         .         .         .         .         .           g.13545
tacaaaacaagaggcagcccttcaggtcaggggagatgttctgaatcagcaaacagacat  c.-36-5101

.         .         .         .         .         .           g.13605
aaaaagaactcttatcttaactatctcctgaaccttgcagttctcctgtaacagccagaa  c.-36-5041

.         .         .         .         .         .           g.13665
cactttaataagactgggatattcttggagatgtggactgggcctaacttttatttctga  c.-36-4981

.         .         .         .         .         .           g.13725
tattccacctttaacctggacctccaagtttttctgtaaagtgagctgtgaaaaaagaca  c.-36-4921

.         .         .         .         .         .           g.13785
ggctggagatccaagatttccttgtgctttcttatgaagtttggtgaagagcaatttaag  c.-36-4861

.         .         .         .         .         .           g.13845
agatattgtcaaggttggtgtgctgccccaaactctgcgactagaaaccaaaagtttcta  c.-36-4801

.         .         .         .         .         .           g.13905
gggaactttttttcttttttttaaacttgaaggccttgctgaaatgctaccttctccatt  c.-36-4741

.         .         .         .         .         .           g.13965
acactttacctaattcctttctctcctgtaacctctgagctaaaggtaatgtctcccatt  c.-36-4681

.         .         .         .         .         .           g.14025
ctatgactgtgttggatagtttggctgtacccctccgtgtcctgcaggatctttcaatat  c.-36-4621

.         .         .         .         .         .           g.14085
ttttatcttgttgctacttacgcacaagtctgatttccgtatcagacttccagagttgtg  c.-36-4561

.         .         .         .         .         .           g.14145
gggtaagccttctattcatttttgtaccgcctgcatgccttgtacctagtagatactcgg  c.-36-4501

.         .         .         .         .         .           g.14205
tatggtaactaaaacatcatcgaccttttcagttgatgacatggtcttcttttcacattc  c.-36-4441

.         .         .         .         .         .           g.14265
cagggcttctctttacttctctagcctgtggtaagttaatatattatcacaaccaaagcc  c.-36-4381

.         .         .         .         .         .           g.14325
tagtccttgcaagatatcccttccactgtttctgacctttttttctttggcttctacttt  c.-36-4321

.         .         .         .         .         .           g.14385
ctacccctgcacattgctctggcctggtgaaaactctggtggaaacatggcttgctagat  c.-36-4261

.         .         .         .         .         .           g.14445
ccgtgtcatagctcagtgttgggctgggagtcaagggataaaagattctgcctgcggttt  c.-36-4201

.         .         .         .         .         .           g.14505
ctctcctgttgcagatgttactttgggcaagccatgttttccccttctgccttattgccc  c.-36-4141

.         .         .         .         .         .           g.14565
tcatcttttcaatggcgttgtggcaaaatgtctcttcaaatcaccagaattattaggaaa  c.-36-4081

.         .         .         .         .         .           g.14625
cacatgtaggtgtgttcaaatattactccacatgtgggggtctttggtgtttctgttggt  c.-36-4021

.         .         .         .         .         .           g.14685
tacaattagactgtaagacacaagttttgtcatggttggagtggtgacccttaaaattcc  c.-36-3961

.         .         .         .         .         .           g.14745
atgaagttgaactccttttaatatgcagatggctgtgctgagcctttcagctaagggcag  c.-36-3901

.         .         .         .         .         .           g.14805
aggagatttgggctgagggaggatgactgtggtgtttggagctctggcaagctcctctgg  c.-36-3841

.         .         .         .         .         .           g.14865
ggcctcttctttttaaaaacacacactctctagttgtgaatgtaggaaagtgggaagtaa  c.-36-3781

.         .         .         .         .         .           g.14925
ggacgaaatcaagacagagtatactgctgagaaattcttgcctaagaacatagtggtttg  c.-36-3721

.         .         .         .         .         .           g.14985
gccctcggggagtcctggtctgggggagggtggggaccagcaatgcatgtgtatggggag  c.-36-3661

.         .         .         .         .         .           g.15045
gttgctgtgcccccctctccccagatacatttttgtcattatgtttttagccacagacac  c.-36-3601

.         .         .         .         .         .           g.15105
atagttgtggaacaggtcgttcttttctgtgacaacgggaaactccctccttctcctaac  c.-36-3541

.         .         .         .         .         .           g.15165
acaaaataaaaatagattttgtgtgttattatgtgagcagacctaccactgccctgtgaa  c.-36-3481

.         .         .         .         .         .           g.15225
gtccatctgggccctctcctccagcccaccctactatgcttactgctgtcgtcaccaccc  c.-36-3421

.         .         .         .         .         .           g.15285
tatctctattgtctcattagtgctttggagaagaaaggggtagagagtccaggggatact  c.-36-3361

.         .         .         .         .         .           g.15345
ggcagggctggtgagggagaagtggagttggccaatactggactttaaaccttaaccata  c.-36-3301

.         .         .         .         .         .           g.15405
ctaacttagtaatgatgtgctgcttgagactagcacctctttctaatttatttccccagg  c.-36-3241

.         .         .         .         .         .           g.15465
tttcttcatactgtgggaaagtttaattacatacttgaactgtaaaataaaattgccacc  c.-36-3181

.         .         .         .         .         .           g.15525
cgaaatgtagaggaagaataagaggccaggattataggcctcatcttagagagtcctccc  c.-36-3121

.         .         .         .         .         .           g.15585
cttgggtttacttgggtgatggtagccacagcagatcctagggcagccctgattttgcct  c.-36-3061

.         .         .         .         .         .           g.15645
tggaagtccattaatggactttccaacacacaggtttggatgaagtcttcaagatgctct  c.-36-3001

.         .         .         .         .         .           g.15705
ggaggcagcaggcatcaagtcacggatggacagctggaagggacctttgagatactccta  c.-36-2941

.         .         .         .         .         .           g.15765
tcctgagcctagaggaagtcaggaccccagacgaaaggcacttttcccagggccctagag  c.-36-2881

.         .         .         .         .         .           g.15825
ttggtggtgaccctgagaccagaacccaggtctctcagctcccagtgagacatcagtgaa  c.-36-2821

.         .         .         .         .         .           g.15885
tatcacgtcacgttctatgagagtccagatctctgccattcattagttatatggcacagg  c.-36-2761

.         .         .         .         .         .           g.15945
gtacatttcttcatttgttaaactgtactgttagtctgagccacacacatgcattgaagt  c.-36-2701

.         .         .         .         .         .           g.16005
ccaggcatctgaggttctcttcttattaaatagtttcctatataacacgttcctatatta  c.-36-2641

.         .         .         .         .         .           g.16065
acattccaattatatgcccgtaattttccacttcccttccaacatgttttccctctaaga  c.-36-2581

.         .         .         .         .         .           g.16125
cgtttttaatagtttcctttagcaaaaaaaacgaggagcatttttatgggactatgtatg  c.-36-2521

.         .         .         .         .         .           g.16185
agtaattacaacattctctgagattcccaggtggaaatgataatgcatgtggaaagtagc  c.-36-2461

.         .         .         .         .         .           g.16245
attatgggctaatgtatattagaatttcatgtttaatatacatcaattatattaaacgta  c.-36-2401

.         .         .         .         .         .           g.16305
ggaatatcagcctaacttcagtgtttgtatcttcattgttcaaactcgtggtatattact  c.-36-2341

.         .         .         .         .         .           g.16365
ttaatacctattgaagctgatttcagtgtaaaccataacaggaagtaagcaatttccttt  c.-36-2281

.         .         .         .         .         .           g.16425
tattcactaaaaaataaaagggtgtattagtgtgctcatatacatgaaagagcattgtat  c.-36-2221

.         .         .         .         .         .           g.16485
cttgtagtagccctgaatcgacgtcagcttcctaaatttaaaatgctgactgaacctgtg  c.-36-2161

.         .         .         .         .         .           g.16545
tgaggtggtggaaagcaaaaagaaaaaaaagttccgtctgctttgttcatcacaaagaat  c.-36-2101

.         .         .         .         .         .           g.16605
aaataataacattgggctctctagtgaattcaaggctgtaattcactgttgaggctcccc  c.-36-2041

.         .         .         .         .         .           g.16665
tgttgtttagaagccacttgtactgggttcccttagtcctgttttgatcccctgcttatg  c.-36-1981

.         .         .         .         .         .           g.16725
atcactctgaagtagcctttgactgcttcctgtttcagctctaatttacttgtcaaaatg  c.-36-1921

.         .         .         .         .         .           g.16785
gcctaaattcttgcctacactttaaggatttctttatgggaacacaactcaaacactgat  c.-36-1861

.         .         .         .         .         .           g.16845
gactctgtggtttttatttataaaattaactgaagctggctacagtggctcacacctgta  c.-36-1801

.         .         .         .         .         .           g.16905
atcccagcggtttgggaggctgaggtgggacgatcacttgaggccaggagttcaagacca  c.-36-1741

.         .         .         .         .         .           g.16965
gcctgggcaatatagtgagactctgtctttacaaaagataaaaaaaattagcttggcacg  c.-36-1681

.         .         .         .         .         .           g.17025
gtggcgccgcctgtagtcctagctacttgggaggctggttggggaggatcacttgagcct  c.-36-1621

.         .         .         .         .         .           g.17085
aggagtttgaggcttcagtgagccatgatctctactgtcctccagcctgggcaatagaga  c.-36-1561

.         .         .         .         .         .           g.17145
gaggccctgtctctaaaaatatgaaaaattaaaataaagttaaaattaaaaagttgattt  c.-36-1501

.         .         .         .         .         .           g.17205
tattaatagttggcccttgaaatttactctgcagttgattcatcagataatttttgagct  c.-36-1441

.         .         .         .         .         .           g.17265
atgactatatgctggttgaggtgctgggaacgtggaagggaaactgagcatggcctgcct  c.-36-1381

.         .         .         .         .         .           g.17325
tcatggccctcatactctagagattcagtgcaagtgatgggtcgctaggagtggaaagaa  c.-36-1321

.         .         .         .         .         .           g.17385
tgtgttttgtgtactgcccctccagcccgccattccactgtgggtaaagagccctgctat  c.-36-1261

.         .         .         .         .         .           g.17445
ggtgactaggccaccacggtctcattccatctctgccactaaacaatgggtaagcaaatc  c.-36-1201

.         .         .         .         .         .           g.17505
acttagggtatgtcattctgtattttgtgaggctgacagcaaaaagtttctccatgtaca  c.-36-1141

.         .         .         .         .         .           g.17565
gatgtgtgcctccaaggtaacatcataatatagaacaattactgttgctagtggaattca  c.-36-1081

.         .         .         .         .         .           g.17625
gctatcttgccggcatcattgatctctatcagaatgtggaaaacagcttatttgctcatt  c.-36-1021

.         .         .         .         .         .           g.17685
ctggctcatagccaagatgcagttgtacccactctatgaggcatttccaatggggatgcc  c.-36-961

.         .         .         .         .         .           g.17745
aagaagccttggagtgtgggtggtggaatatagttctgctgaaattgtagaaccagaatt  c.-36-901

.         .         .         .         .         .           g.17805
tccacacctcatctgtggtgagctctgatccagtagtcatggatgacttctctcaaggat  c.-36-841

.         .         .         .         .         .           g.17865
tcttgaccagagccaggtctgggacaaatccctggttttaactgtctgagggggtctctg  c.-36-781

.         .         .         .         .         .           g.17925
cttcaattaattagctggcaagaggatcacgtcttaaactgtccctcctgatcacttctg  c.-36-721

.         .         .         .         .         .           g.17985
gtagggtggagttggtggggaaagtaatgctaaataagggtggccgtttgttgtgctgag  c.-36-661

.         .         .         .         .         .           g.18045
actacagctgtgtttttcacacatgtcattgcattgaaatctcaaaagaagaaacattaa  c.-36-601

.         .         .         .         .         .           g.18105
ataacgtagctagtaattacatatatgagtatttgaacccatatttgtctgattcctata  c.-36-541

.         .         .         .         .         .           g.18165
gcctttgcttttttcatgattgggacttctctttcattctcaaattagaagattgtattt  c.-36-481

.         .         .         .         .         .           g.18225
ttcccggtttaactatcttgaagttttgaatgcccactcacttatgaaaatgagtcttgg  c.-36-421

.         .         .         .         .         .           g.18285
ttggatactttttaaagggttctgtattttaatggctttgtgggggttaatgtcttgtaa  c.-36-361

.         .         .         .         .         .           g.18345
ggtgtccaaggtagtaagtaatggagagcatctgttgacttcagtaataaatttcaaact  c.-36-301

.         .         .         .         .         .           g.18405
tgtttagaattctgcttatgtgttaaatttgagtttctccagtgagtccttttgtatctt  c.-36-241

.         .         .         .         .         .           g.18465
agatgatttatatttttctggggaatcatttagtgtgtgtgttttttttaaacaagtggt  c.-36-181

.         .         .         .         .         .           g.18525
cttcataaagactagggcagacggatgtatatcacactcactcaaacatctggactagac  c.-36-121

.         .         .         .         .         .           g.18585
agggcagctctgtttgatgtttgttacagaaatggcaccatcaaatgctaacaattgttt  c.-36-61

.         .         .         .         .         .           g.18645
tattctggtcttaacatcatgtttaaaacatgccttccttttttctgcttttcaacttag  c.-36-1


Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center