SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2) - 3704 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.18966
gtaagagtttgttctcccattcaaactcaacttctgataagtggatggctaatatttctg  c.225+60

         .         .         .         .         .         .  g.19026
ataaccccatccccctttctactgttgttaacaagaaaatcatgcaagatctttgtcttg  c.225+120

         .         .         .         .         .         .  g.19086
tatatctcatatattattaaaaacgcatattgtgaggtacttttattgctacagatgttg  c.225+180

         .         .         .         .         .         .  g.19146
catcagttatgaagatcagatgttggctttttaaaatactgacatagactatgcagttct  c.225+240

         .         .         .         .         .         .  g.19206
gataagtagatcctgtgatttgtgggttgaaggtatttttgtcttggtgaattagtacat  c.225+300

         .         .         .         .         .         .  g.19266
tagtctataagtcttattttttcctatctgtgttaagtaacttatccactaatgaacata  c.225+360

         .         .         .         .         .         .  g.19326
ctgaaaattattctttcctaaaaaggctgacatttattaacaaaaattagatcccaaaga  c.225+420

         .         .         .         .         .         .  g.19386
gtagaaggaaaaagtccttatctaaaggattttttggaaagggctttattgaaattaaat  c.225+480

         .         .         .         .         .         .  g.19446
agtttctagggaatccttaaaatgcacattgctgtctctctgtgaagcacttttattctg  c.225+540

         .         .         .         .         .         .  g.19506
gttttggaagaaggttctgatttttgcagagctcacgtccagctgtttatttctggacta  c.225+600

         .         .         .         .         .         .  g.19566
aggttgtaattatcctttatttatgaggcttggattgttgctgtggggatgatcatatct  c.225+660

         .         .         .         .         .         .  g.19626
gtacaacttggcattatgccttcacaggagatgcaaagaagagagacagccttttgagaa  c.225+720

         .         .         .         .         .         .  g.19686
agtaaacaagatcctctgtgacagtttgctttgaaagtaagcaatagccaagaaaaatct  c.225+780

         .         .         .         .         .         .  g.19746
atgaggacattacatactacctgaaggttttgcctaatgagacacgtagaggttttacac  c.225+840

         .         .         .         .         .         .  g.19806
tccttgggatgatatcacaggtggatagggtggcagggctgcttcttgacattaagtagg  c.225+900

         .         .         .         .         .         .  g.19866
tgtattcattaggattctccagagaaacggaaccaataggagatagagatatatgtaaaa  c.225+960

         .         .         .         .         .         .  g.19926
agagacttattatgaggaattggctcacacagttatggaagctgagagttctattatctg  c.225+1020

         .         .         .         .         .         .  g.19986
cagtcaccaatctggatacccagcagaacctgtggtatagttccggtctgagtctacagg  c.225+1080

         .         .         .         .         .         .  g.20046
ctcagacctgagcctgagaaccaggagttccaggagaactgatgatgtgagttccagtga  c.225+1140

         .         .         .         .         .         .  g.20106
tgtgagaaccaggagaaccaggagaactgatgatgtgagttccagtctgagtccaaagag  c.225+1200

         .         .         .         .         .         .  g.20166
ccagaagagtcagtggagtaagttcaagtctgagggcaggagaagacccagcttaagcag  c.225+1260

         .         .         .         .         .         .  g.20226
tcaggcagagagaaagcttctcctttcctctagctttttttttttttttttttcttattc  c.225+1320

         .         .         .         .         .         .  g.20286
aggccctccatggattttgggtgaggcccaccgacattgctggaggcaatctgatttatt  c.225+1380

         .         .         .         .         .         .  g.20346
cagtctaacaattcaaatgataatctcatccaggaataccctgacagacatacccagaaa  c.225+1440

         .         .         .         .         .         .  g.20406
taatgtttaatcaaatatctaggcacctgaggcccagtcaagttgacacataaaatgaac  c.225+1500

         .         .         .         .         .         .  g.20466
cattacagtagacaagccgtggaagatcctggcttaaaacaaaaagattaccacagaaaa  c.225+1560

         .         .         .         .         .         .  g.20526
gagcaagtctttcctccagttacgtaggactttaggtcagttttagggtagggcatcaga  c.225+1620

         .         .         .         .         .         .  g.20586
gcccaaaagggaagatccttttgttaaaagtgttgtaatttgatgatttttcaaattagg  c.225+1680

         .         .         .         .         .         .  g.20646
aaagtaatatatggttattttgaaaaggaaaacaatactgagataaacagataatcttac  c.225+1740

         .         .         .         .         .         .  g.20706
cttcaccccaagtaacagcttgttgtacatgctttttctatcttgcttttctgtatgttc  c.225+1800

         .         .         .         .         .    g.20758
attacaaatactgtgtaagcacagatatgtatatattggtgtttttttttgg  c.225+1852

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.20810
        ttacttttcttttgctattatagaatcatgttgtctctgttaattactctgt  c.226-1801

.         .         .         .         .         .           g.20870
aactttcttttttcatttaacaatgtattatggatatccctatgacattctctagttttc  c.226-1741

.         .         .         .         .         .           g.20930
tgtctcctctttttaacagatacatttgttagcttgtcagagatctagagaaataaagct  c.226-1681

.         .         .         .         .         .           g.20990
gctcgttttccatgtcatatttttcaggggacctattgaacatattgacatccaagtcct  c.226-1621

.         .         .         .         .         .           g.21050
gaaattgttttctgtttagattaaatgaatttgggagctatattctggatctgatcaatg  c.226-1561

.         .         .         .         .         .           g.21110
acttgtaaaccttcctctaagtggcttacataatttcagaataatttgaaggtgtctcac  c.226-1501

.         .         .         .         .         .           g.21170
cttcaaaatgaaagataaaatgtgagggaaatacttagctaaactttattgttctttagc  c.226-1441

.         .         .         .         .         .           g.21230
agttaaaaattcaatgtgtgagtgttgggtcagtgttatgtttttctcctggattgtttt  c.226-1381

.         .         .         .         .         .           g.21290
tattaattgttatctcttctgatcccttcattttatgtcctagcatttttattacacttt  c.226-1321

.         .         .         .         .         .           g.21350
ctcatattctctctaccctcttaaatactccctctttttgttttgctttgctcgcattct  c.226-1261

.         .         .         .         .         .           g.21410
gtgagttttgcattttttgccatcctgcttctccttggccccagcccctcagatagttcc  c.226-1201

.         .         .         .         .         .           g.21470
ctgcgtgaggacacgggtgagggtttagagctcacacctgctgaccagatgccttcactt  c.226-1141

.         .         .         .         .         .           g.21530
ttttctatgctttttataggcagttttatttcttctcttattcttccttcttcctctgag  c.226-1081

.         .         .         .         .         .           g.21590
gcttcagctttttgcttttcaacattactggaaataaataaacaagtggcctaaatacat  c.226-1021

.         .         .         .         .         .           g.21650
ctgctgtgttgctttgatttcctctctattattactatttaacagactcagtgacactct  c.226-961

.         .         .         .         .         .           g.21710
ttataccagattcttcccatttttcttccaaacatcctctttatgatacattttttcctc  c.226-901

.         .         .         .         .         .           g.21770
ttttcaagtgcatacttttgactctgcagaaattaactttcttttctccaaaactgcaaa  c.226-841

.         .         .         .         .         .           g.21830
cactcatactttcttgcttgaagtcatttggtttctataaactcctggaaatatttcttt  c.226-781

.         .         .         .         .         .           g.21890
caggctgttttgaaaattgctattacagtttggggaggaatagacttttcctttttcaaa  c.226-721

.         .         .         .         .         .           g.21950
cacatgcttcattgcccaattctggattggattaatgtcgattcaatagctgtttattgc  c.226-661

.         .         .         .         .         .           g.22010
atgtctgtcacgtattatgcctcaagttttgggtccagcccctgtgttcgtttatttcca  c.226-601

.         .         .         .         .         .           g.22070
aactgtgcctttaaccttttccgttcctcctccctctgtagtacagctttatctattgca  c.226-541

.         .         .         .         .         .           g.22130
cacactttccttttcagtattcaccccccattcacggctctgtcctgtctgttcctctct  c.226-481

.         .         .         .         .         .           g.22190
ttccaactgccatggaaccctgtggtttcaactttcaaactttccatggttccttccctt  c.226-421

.         .         .         .         .         .           g.22250
ccaatgaagaaaaattaccaaaaactggatcatcacagatgtgtcaaacagccttccttc  c.226-361

.         .         .         .         .         .           g.22310
agacttcagactaacttcaacatataacaggtttcaagattacttaccagggtatggaaa  c.226-301

.         .         .         .         .         .           g.22370
aatagcctatatttgtctaccttgtgaccaggacttcattttcattgcctgttctgatat  c.226-241

.         .         .         .         .         .           g.22430
tacaaaaaacaaacaaacaaacaaacaaacaaaaaaacaaccctccactgtttaaagact  c.226-181

.         .         .         .         .         .           g.22490
taacatttgacttacagatagtttgctgatccttttggtctagtctctttttttaactct  c.226-121

.         .         .         .         .         .           g.22550
agaatgggtagtagatgatagtgccacacttttaaagaacttaggaaggggtctgaaaac  c.226-61

.         .         .         .         .         .           g.22610
tccaaatagaaatattttaccttatagaggtgtctaactaatgtcctttaaatgtttcag  c.226-1


Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center