SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2) - 7112 nt intron 05 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.37203
gtaacgcaccccgccagcaaggggccccctgcggtgtgctagcacctgccgcccaagccg  c.1046+60

         .         .         .         .         .         .  g.37263
aggggggtgaggcgcctgcctccttggttggccaaactgtgattttcacccgtgcggtcg  c.1046+120

         .         .         .         .         .         .  g.37323
gaaaactttcatccactcctggggccttcccggtgctgaggggaggcaccggggttttga  c.1046+180

         .         .         .         .         .         .  g.37383
agatcaaaagccgacggggacttcctgtggacccgagagagtgatcatctcacactgcga  c.1046+240

         .         .         .         .         .         .  g.37443
ctgtggaatacactgtccgtgtttgtgcttgtgcggttcggtgatgacggaggggctggg  c.1046+300

         .         .         .         .         .         .  g.37503
acgctgagtgtgttgcgctggcctgattttcatgttaactgtacgtttctactaaagcat  c.1046+360

         .         .         .         .         .         .  g.37563
ccttcggtagcttggtataatctttgttttaattcacgtgtgtctatgcagtgatccagc  c.1046+420

         .         .         .         .         .         .  g.37623
cttatgggtataccctgtgcgagtgtctttatacaaggtctatacttaaatcattagtcc  c.1046+480

         .         .         .         .         .         .  g.37683
agaagcttaatttttacctgattcagccatttagcagaatcaggggttttggtaaactct  c.1046+540

         .         .         .         .         .         .  g.37743
tcctgtaaagagccagatagtcaatgttttatgcactctggggccataccgtctctgtca  c.1046+600

         .         .         .         .         .         .  g.37803
caactcacctctacccttgcagtgtgaaaacagctgcagacaataatgggctggctgcct  c.1046+660

         .         .         .         .         .         .  g.37863
ttcggtaaactttacaaaaacaggctggaggcagaatttggcctgcaggctgtgtttacg  c.1046+720

         .         .         .         .         .         .  g.37923
agacccctgatgtaaatggttaatgtcaacccaaaagggagtccggcaagtattaagtca  c.1046+780

         .         .         .         .         .         .  g.37983
agataaaatgaagctaaggttgtggattctggagtctgccagaaagcatactgtgtcatc  c.1046+840

         .         .         .         .         .         .  g.38043
agtaacttcttaccgtggcgaagttatgtctcttttctgtgactcagtttcctcctaggc  c.1046+900

         .         .         .         .         .         .  g.38103
taaaagaagatacctctcatagtgttgggaagataaaatgatactgaaacattcaataaa  c.1046+960

         .         .         .         .         .         .  g.38163
taatacctattattatttcccaaagactttaattttaaggaaaattagagtttaaaaatt  c.1046+1020

         .         .         .         .         .         .  g.38223
atagagaatgttggtaaacagtgtctgggcttccttttaaaaggttaccttaatctttat  c.1046+1080

         .         .         .         .         .         .  g.38283
tgaaaagcacatcactcatttcttatcagactaaaatactaagttaccagcctagagagg  c.1046+1140

         .         .         .         .         .         .  g.38343
taatctgaaagaaatcagaataacttgccattagatgtgtttatttttttggatgaagaa  c.1046+1200

         .         .         .         .         .         .  g.38403
tataactttattctcatcactattaataatcatctgttaagagattttatattgctattt  c.1046+1260

         .         .         .         .         .         .  g.38463
ccaccatttcatgtattcccagagagctagatactcattgtcaattgatatttcagtgct  c.1046+1320

         .         .         .         .         .         .  g.38523
gataggcagattctgctgggtgaataattgctgtgtgttataaagtcaaatactagcata  c.1046+1380

         .         .         .         .         .         .  g.38583
ttcctctattcatgtgcaatagactaatgtgcagtacattctgtatgttactgttgagtt  c.1046+1440

         .         .         .         .         .         .  g.38643
tttaaaaagctaaaagtattggaaaaagtcagtaatagaatagagaaatacaatgtggat  c.1046+1500

         .         .         .         .         .         .  g.38703
gctctaaaattctgacttcctaagagctgatattttttttcctaccctaggaaaggaaaa  c.1046+1560

         .         .         .         .         .         .  g.38763
agctctgtacaagctccctagttaaaacattttttttttccatttgaattaccagtacct  c.1046+1620

         .         .         .         .         .         .  g.38823
ttgttaaactatgtgaactacccttagaagagagatgctttctatagctagaaattttta  c.1046+1680

         .         .         .         .         .         .  g.38883
catatgtctagacttctttcccttattcagcctggtatgtgtgtgtgcacaagtgtgttt  c.1046+1740

         .         .         .         .         .         .  g.38943
taactttttattttgctaactcctaaatgttcttaatcattttttctggaattttcattg  c.1046+1800

         .         .         .         .         .         .  g.39003
caggactttcttgtaataagtttattttaggaacttttttggagattaccttagtggatg  c.1046+1860

         .         .         .         .         .         .  g.39063
gtcttccaaagtgcacagtattaagtagtactatttggcctattccaatgtgtaaaaagc  c.1046+1920

         .         .         .         .         .         .  g.39123
ttttgttctgccctcctatgtcaataaaaaatgctgtcagtatcttttaaattacatgca  c.1046+1980

         .         .         .         .         .         .  g.39183
ttacaaaatgtggagaatggcaatttttcatagtattattattgctttataaatgcctac  c.1046+2040

         .         .         .         .         .         .  g.39243
tcttttgtaaagccatgtggcttttgaaacgactgatctggacaaccctgaatccagaaa  c.1046+2100

         .         .         .         .         .         .  g.39303
ggtcatgggtcctttggtctgaattttctcatggccacctggagaagaagcacagtttgg  c.1046+2160

         .         .         .         .         .         .  g.39363
tggtgacagcattatggggcatgttttgtattctttggttacagagcaatagctctcttc  c.1046+2220

         .         .         .         .         .         .  g.39423
tgcctatttgaaggtaagttgttcaactgcagagattaaatttatcccttaaaagggtta  c.1046+2280

         .         .         .         .         .         .  g.39483
aatgaagtcccttaggcacttgcaaaagacaacaaatgaaccattttttttcttcttttg  c.1046+2340

         .         .         .         .         .         .  g.39543
accctttgtgacagaatggcttaccagcctttagcattgataactgttaggatccagttc  c.1046+2400

         .         .         .         .         .         .  g.39603
atctttatcatccgatcaaagattagagaggggtctaaaaaacctcttttacaatttgat  c.1046+2460

         .         .         .         .         .         .  g.39663
aaacttagtttcagcaaaaatcatctgtcagaaattcttgaacagatgttaatttctttg  c.1046+2520

         .         .         .         .         .         .  g.39723
ggtcttgtaatatcatttaccttgtctatgaaatttgacaggaagttttcagcatcttaa  c.1046+2580

         .         .         .         .         .         .  g.39783
atttttttaacgtttaagtcagttggctgcttttccttgttcatcataaaatcagaacgt  c.1046+2640

         .         .         .         .         .         .  g.39843
tgacaaattgaccttctttttcattcatagcataaataaatgtctgcctatgagcacttt  c.1046+2700

         .         .         .         .         .         .  g.39903
gctgcagctctgtacaagctctctagttcaaacatttttcccacttaaattggatccttt  c.1046+2760

         .         .         .         .         .         .  g.39963
ctttttgaccatctttctcttataatggaactttattacttccatagtaagtgtcagaga  c.1046+2820

         .         .         .         .         .         .  g.40023
gatgtttccctgtactgctttttttttttcttttttttctttttggcacacttttgatgc  c.1046+2880

         .         .         .         .         .         .  g.40083
cttctcattgtgcctaacttcgctttcttctatttagagttagatgtctgatcaaaagta  c.1046+2940

         .         .         .         .         .         .  g.40143
cctcaggaatcatcacattggcatgtaaactaattccacacatgtttgcctggaagatgt  c.1046+3000

         .         .         .         .         .         .  g.40203
atttcacacttgaaggggtttatttgggaagaacatgtctgaattatatcagccctcttc  c.1046+3060

         .         .         .         .         .         .  g.40263
ggaataaagtcagactttagtatgaaaagagcggtatatcctctttgtgtcaggaagcag  c.1046+3120

         .         .         .         .         .         .  g.40323
gcataggctgcttacctgtgatttttttttttttttgacctgcccttgtcgccattgcaa  c.1046+3180

         .         .         .         .         .         .  g.40383
tcctgaaaattccttctcaaaaattaccagtagctgctttaccagcagagttacaaaaag  c.1046+3240

         .         .         .         .         .         .  g.40443
tcacacacgctctctttttaaagtgtcactcagctccttgaaggaacaaaatgtaccagt  c.1046+3300

         .         .         .         .         .         .  g.40503
gtcattttctgttcagataactctcctacaggaatcataaacttctcctctggacctgaa  c.1046+3360

         .         .         .         .         .         .  g.40563
caagtatctgttgcatttaatgcaactctttttcttgccagaacagtaacccctcgtgat  c.1046+3420

         .         .         .         .         .         .  g.40623
ttactgttcaatctgtatgaaaaacctgtgtgacctaattctgcatcaattttctgtact  c.1046+3480

         .         .         .         .         .         .  g.40683
cgtgaggacgctaaatgagtcccctgcagttatgcagtattacatcttgttgttgtttgg  c.1046+3540

         .        g.40699
ggaagtttagaatcct  c.1046+3556

--------------------- middle of intron ---------------------
                               g.40700            .           g.40715
                               c.1047-3556  gaatctctttatcgga  c.1047-3541

.         .         .         .         .         .           g.40775
ctacctgctgaatctcactgatggggagatgaaattgtctggagaggaacattatttaaa  c.1047-3481

.         .         .         .         .         .           g.40835
atgaagatttctattaacaacaacaacatcaacaaagatataatcttctgtgttaaagaa  c.1047-3421

.         .         .         .         .         .           g.40895
gcccctcctgtacctttgcttcttccccaccatgtgctgaatcaaatgcatataatttta  c.1047-3361

.         .         .         .         .         .           g.40955
ctatggagtctacctttcctcttctcctagagtttgcgctttgtacttcttgcctccctt  c.1047-3301

.         .         .         .         .         .           g.41015
ccagaaaagggattcttttgtgccagggaatcagattcactgacaaataactgggctcct  c.1047-3241

.         .         .         .         .         .           g.41075
tggagaaggagtcatttcagggagaggtgcacccccctcgctcccactctctctctccag  c.1047-3181

.         .         .         .         .         .           g.41135
tgcctaagtcacacagtgccccatctccccggggttcccaccccccatctcctcatttcc  c.1047-3121

.         .         .         .         .         .           g.41195
gctccacttccctgcttcccacctcccagttcaatgtgatgtaatctctaccctatcacc  c.1047-3061

.         .         .         .         .         .           g.41255
ccagttatctgacgattacttatttagtcctagttccatggttgtttggaagattaagta  c.1047-3001

.         .         .         .         .         .           g.41315
ggaattcctctaatttggcatctgacccactttgtcaaagagagtaaatcagaataccaa  c.1047-2941

.         .         .         .         .         .           g.41375
gggatagtttgagttctaggatattcaaataagaaagatctgcaaggaatctagaaccaa  c.1047-2881

.         .         .         .         .         .           g.41435
ggatgcggaataaccaaatcattggccatgggctcacgccactataatacttaattttcc  c.1047-2821

.         .         .         .         .         .           g.41495
tttggtatggccttaacctgtgaaagtaaagttgtctcagttttattttttccctttaaa  c.1047-2761

.         .         .         .         .         .           g.41555
ttatatatttcaaaaaaaatcaatagtggatttttttctttacatcttaattgttaagat  c.1047-2701

.         .         .         .         .         .           g.41615
gcatcatctgttgctgtatccagagatttggggctacatagatgttgtagaaaatgagta  c.1047-2641

.         .         .         .         .         .           g.41675
aatgaagtagatgtctgtttcatatagtgaaaattaaaaaccacggtaataatctcacga  c.1047-2581

.         .         .         .         .         .           g.41735
gtatcactagtacaaggaatgtggaagaaagttgggagaatttgaacaattttgccaaaa  c.1047-2521

.         .         .         .         .         .           g.41795
gagtaaaatgatgagtttattattgttgcatgaaatacaaaactttcagtcttttgaatg  c.1047-2461

.         .         .         .         .         .           g.41855
attaaaccacttaaaaatgctattgtttgtgttggtatgcatagttaatagcacgggcca  c.1047-2401

.         .         .         .         .         .           g.41915
ggcatggtggctcatgcctgtaatcccagcacttcgggaggccgatgcctgcggatcacc  c.1047-2341

.         .         .         .         .         .           g.41975
tgaggtcaggagtttgagaccagcctggccaacatggcaaaaccccgtctctactaaaaa  c.1047-2281

.         .         .         .         .         .           g.42035
tacaaaaattagctgggcgtggtggcacgtgcctatagccccagctacatgggaggctga  c.1047-2221

.         .         .         .         .         .           g.42095
gaggcaggagaatcgcttgaacctgggaggcggaggttgcagtgagcagagatagtgcca  c.1047-2161

.         .         .         .         .         .           g.42155
ctgcactccagcctggccgacagagcgagactccatctcaaacaaacaaagaaaaaacaa  c.1047-2101

.         .         .         .         .         .           g.42215
taacgacagcacggtagcagtgataatattaacacattatgatgacaaatcatttaataa  c.1047-2041

.         .         .         .         .         .           g.42275
attagaacgaataacgtgcgtatagcaaataaaacaagaatcagtcttagatactatttt  c.1047-1981

.         .         .         .         .         .           g.42335
tagtgaagtccctgaaaaatagttttccttaccaccatttttaaatttttaaaaatgatg  c.1047-1921

.         .         .         .         .         .           g.42395
acattttatttcccttccaaactaagcaactgtaggttttttaaaaaatcactcattttg  c.1047-1861

.         .         .         .         .         .           g.42455
atatttgggctatatgaagtattagatcttctacagcatttaggtccaggaggtttcact  c.1047-1801

.         .         .         .         .         .           g.42515
ttttcacgttaatgaaaatgatggctgtcgtcatcagcatcttggcaaggaagacaaatg  c.1047-1741

.         .         .         .         .         .           g.42575
gtctggttgccttaggacagaaccagaagttagaaagaaaaaagtctgtcctcccagctc  c.1047-1681

.         .         .         .         .         .           g.42635
tgtactctggcaacatcatcatgtttggaaaaaactgtaatattcattttttaagacaat  c.1047-1621

.         .         .         .         .         .           g.42695
ttcgacttttattttagattgaggggattcatgaataggtttcttaacatgggtatgttg  c.1047-1561

.         .         .         .         .         .           g.42755
catgatgctgaggtttggggtgcagttgatcccatcattcagctaatgagcatagtacct  c.1047-1501

.         .         .         .         .         .           g.42815
aaaagtttttcatcccttcctgcgctccctccctcccccgtctagtagtccccagtgtgt  c.1047-1441

.         .         .         .         .         .           g.42875
attgttgccatctttatgtccatgaatacccagtgtttagctgccacttaaaagtgagaa  c.1047-1381

.         .         .         .         .         .           g.42935
catgcggtatttggttttctgttccggcattaatttgcttaggataatggcctccagctg  c.1047-1321

.         .         .         .         .         .           g.42995
catccatgttgctgcaaaggacatgatttggttcttttttatggctgtgcataattttta  c.1047-1261

.         .         .         .         .         .           g.43055
acagaattcttaattttcagcttttatagttgaggtccaggaaggttctcggaaagtgta  c.1047-1201

.         .         .         .         .         .           g.43115
tcttaattatctatcattttattgcagtggttttggtatcaggcaaattgaggttccaat  c.1047-1141

.         .         .         .         .         .           g.43175
cttggcccccttctttactagctctgtggtatctccaggtgtcttcagttttcctcatca  c.1047-1081

.         .         .         .         .         .           g.43235
gcaaaatgggaccattataacttttaccttacagaggcgtgtctgtgtgtgtaagagaga  c.1047-1021

.         .         .         .         .         .           g.43295
gacaattaaataacattgtacattaaaggcacttagtgctgttaatattagcctacttta  c.1047-961

.         .         .         .         .         .           g.43355
acttattacttattattattctttctttgttgaaatctagttcagtacagtttgcctcag  c.1047-901

.         .         .         .         .         .           g.43415
atttaggggatgtagttctaaaaatagtcttaaatggcatataattattttgtcagaata  c.1047-841

.         .         .         .         .         .           g.43475
ggattcaggtgaactctaaaaccagcagtttatatatctaacagtaatagtatcccaagt  c.1047-781

.         .         .         .         .         .           g.43535
gaatggctaaagtcagaggtcttttattttctactctgcctttattatgaagaagtacat  c.1047-721

.         .         .         .         .         .           g.43595
gcagttatatttttgatggtgtgtaaaacgagaatcctcaacatccttttctagaaactc  c.1047-661

.         .         .         .         .         .           g.43655
ttggtttttgagtactatttactgctggccctgatttttttaaaacagcctcatttgtat  c.1047-601

.         .         .         .         .         .           g.43715
tttcttttctcaagcaagctctgctcacagaggaagtggttgtggctggcagagcgcttt  c.1047-541

.         .         .         .         .         .           g.43775
ctgaatgtttagggttggctgatttctgtggcatcagcacctaaaactgttcttgctcac  c.1047-481

.         .         .         .         .         .           g.43835
tgcgctttaatggctgtcgtcatcagcatcttggcaaagaagacaaatggtctggttgcc  c.1047-421

.         .         .         .         .         .           g.43895
ttaggacagaactagaagttcggaagaaaaaagtctgtgctctcagctctgcattctgtc  c.1047-361

.         .         .         .         .         .           g.43955
tggctgggagttagaaagcttgtcaattggttctgtctcttatattctctctctgctaag  c.1047-301

.         .         .         .         .         .           g.44015
agtgagcaaggacatttgacttccccactagatgcagggtgaaccttctttccctagtgt  c.1047-241

.         .         .         .         .         .           g.44075
tagatagaggttatggaggaagccacattgttaagtaacatatacctgtctgcattaatg  c.1047-181

.         .         .         .         .         .           g.44135
caaaggtagcttttctctgcttaacatcaaaaattctagttgggtgttagagatcaacta  c.1047-121

.         .         .         .         .         .           g.44195
tcagtatctggaatatgttttgccccggacttaaacctaatgtcattgtttatcatttaa  c.1047-61

.         .         .         .         .         .           g.44255
gattaaattgtaatgtgtttttcccctgcccccttttccccattttattgtttcctttag  c.1047-1


Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center