SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2) - 1948 nt intron 06 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.44442
gtaatacattttccccagtgaatctgagatgtaggaaataaatgtaattgttcctaaagt  c.1173+60

         .         .         .         .         .         .  g.44502
gttatctgtgttgcctttagtctattcaatattgttacaaagatataaagatataaatat  c.1173+120

         .         .         .         .         .         .  g.44562
agtaaaatagtgaatcttttagaccaacagcttacaactaaaaatgatgaagatgaactg  c.1173+180

         .         .         .         .         .         .  g.44622
cttattattctggttttctcttctgtatatgggaaagagtttttcctcctgtactatggg  c.1173+240

         .         .         .         .         .         .  g.44682
ttacaaagtcagagttatggcgttttgttaccatggatgaaaaaccttgggaacaagtgg  c.1173+300

         .         .         .         .         .         .  g.44742
ggtagctcatgtttgcttttatgactccaaggaaaaaccagaaggtagtggattggagct  c.1173+360

         .         .         .         .         .         .  g.44802
tctttgtaagcacagatgtaaagtgcttgccacgactgtgaaaataattttaacaaatat  c.1173+420

         .         .         .         .         .         .  g.44862
ggtagccacgctactgaattagtggttcatcatttatagaaatacataaagcaatgtctt  c.1173+480

         .         .         .         .         .         .  g.44922
atagcttatttattcaccgatgtctaagtttggagtgtttgatcacatcaggctcatgta  c.1173+540

         .         .         .         .         .         .  g.44982
ttgactaatcagtaaattatctgctcttgtagtttacagcagttattaaaagccagtata  c.1173+600

         .         .         .         .         .         .  g.45042
atgacctattttctgatttctaaattagtaagagacaagtggaatgagttagagctaatt  c.1173+660

         .         .         .         .         .         .  g.45102
ttcactttggcgagttttgccttgtggactgaaaaggttcaagtttgctagtccgcagat  c.1173+720

         .         .         .         .         .         .  g.45162
tgcctcactaacccaaaggggataaggaacgtttcattgttagtcagatgggtttgtttt  c.1173+780

         .         .         .         .         .         .  g.45222
gttaaagtctggaacatgcgaaatgaataattaatgagtcaaagtagtttggaagtattg  c.1173+840

         .         .         .         .         .         .  g.45282
acttggtttgttggaggatgtgactaaaatcacaggccactccagttgctattgtggtag  c.1173+900

         .         .         .         .         .         .  g.45342
gaatttgggtgtatatttgccttaccggctataatctcacagatggacattagtggtggg  c.1173+960

         .      g.45356
taggtgctacttgg  c.1173+974

--------------------- middle of intron ---------------------
                                  g.45357         .           g.45370
                                  c.1174-974  ctcttggtttgtga  c.1174-961

.         .         .         .         .         .           g.45430
gagtagatttcagcttaaattttaaaaagaaaagggaaaattctctgagttctgtttact  c.1174-901

.         .         .         .         .         .           g.45490
tctttcttattggtgacctcataagatgaattaataaagtgctggataaaatcttactaa  c.1174-841

.         .         .         .         .         .           g.45550
atgaatattaaccaagtatattttccggaatatgtttatgttcaaattagcgttgccatg  c.1174-781

.         .         .         .         .         .           g.45610
acggactcttattgatttctgatttttgtttgatattattttaaaaatctgttatttatg  c.1174-721

.         .         .         .         .         .           g.45670
aagcttcctaattaaattaactgtaactaatgatatttcagatgcagtggaatgattatt  c.1174-661

.         .         .         .         .         .           g.45730
taatgtgtattctccagtccctaccccctaccaccacataacatgcaatacagataaaag  c.1174-601

.         .         .         .         .         .           g.45790
tattacatttgtgatctgaaataagttcatgatataatataaaatgtagatctcttggaa  c.1174-541

.         .         .         .         .         .           g.45850
agaagatcattattggagtgggaagaagccaaaactcatatttcccatcctttgtatgag  c.1174-481

.         .         .         .         .         .           g.45910
actatgaattaacgttgtttgagtacctgctgctaccacacgtgaaagtaattcttttat  c.1174-421

.         .         .         .         .         .           g.45970
tctttttttggagcatcattaaaattaatctttaaacacaaagagaatgttaacatgaca  c.1174-361

.         .         .         .         .         .           g.46030
cttaaaacaaagcggaaaatttaaaaagcttatttagctaattggtatcattagaataat  c.1174-301

.         .         .         .         .         .           g.46090
tagagaaaatgaagttatttaaaaggcaagacaacatcttttctttcttttactgttaca  c.1174-241

.         .         .         .         .         .           g.46150
gtactataattgcttttgatttgaattatttggggagaaaaatcttgtaccgttcttgaa  c.1174-181

.         .         .         .         .         .           g.46210
aatattgcatacatttggcatgattttagttccttcatttaatacaaaccaaaggtgatt  c.1174-121

.         .         .         .         .         .           g.46270
gagaagcttgtggagattccccgccccactctattccattaaatgcaaccgcgagaaggc  c.1174-61

.         .         .         .         .         .           g.46330
cagagttcaggaacctagcttctgttagggaaggctgtctaactgctctcttcttgacag  c.1174-1


Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center