SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2) - 2740 nt intron 10 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.60190
gtaagggatcgtcatcctttccactgtgttctgctgaatggagtctgtgccatacctggc  c.1746+60

         .         .         .         .         .         .  g.60250
agcaccattcttcatgcatactattttattcttactgtgctatttattttaagtaaaaat  c.1746+120

         .         .         .         .         .         .  g.60310
agtaatacattagcatagtagaaaattagaatgatacaaaagggatacagtgaaaaataa  c.1746+180

         .         .         .         .         .         .  g.60370
tctacttacatgtcagactgtcaatcaactgatattaaatgtcttgcatagtatttcaga  c.1746+240

         .         .         .         .         .         .  g.60430
attttctgtgcacatataatcgtatgtttacaaatatataggatgtgtaagaatcttaaa  c.1746+300

         .         .         .         .         .         .  g.60490
tgattctataattatattgcccaataaatgatacagaagcataaaatatgacacagtttc  c.1746+360

         .         .         .         .         .         .  g.60550
tctagtttattattaatttgaaattataaaaatacataaactaaagaagtcacatatttg  c.1746+420

         .         .         .         .         .         .  g.60610
gttaacttatttttgaaatttttaatgggcttgccatatagcttctatgtgtatgttcat  c.1746+480

         .         .         .         .         .         .  g.60670
cagcctagtcctaaaattcatttcctagtagttccagtattctcctgaattatgaggata  c.1746+540

         .         .         .         .         .         .  g.60730
caattaatttattggatttttttctgaagaatttaaggttccctgccagcgattcacagt  c.1746+600

         .         .         .         .         .         .  g.60790
gaggaggcacactcccagagcaggatgggaagggagtttgtttcaaattatcttcatttt  c.1746+660

         .         .         .         .         .         .  g.60850
gtctcataaattctgataaacctacttggaggatcagagtgggtgggaggttgccacttc  c.1746+720

         .         .         .         .         .         .  g.60910
ccattctggtatcactctgcacacagttgtattgtgaactcaaaacagtggagatgcaga  c.1746+780

         .         .         .         .         .         .  g.60970
aaaaaaagattgaaccactattctatgcagaaacctcttgaacaataaatgttacttaac  c.1746+840

         .         .         .         .         .         .  g.61030
cactataatctatcacaaggaaagaaaggatcaggataaatatctgatgtgtgagaaact  c.1746+900

         .         .         .         .         .         .  g.61090
ccgtgggctgttactggttaagaatactatatattagagcacttagaaacaactctaatt  c.1746+960

         .         .         .         .         .         .  g.61150
tgcaaaagcccagccttacctaagaatgcctcccattggtctataattaacaagcacaca  c.1746+1020

         .         .         .         .         .         .  g.61210
gggagagatttaacatgttagcgtaatagtgttcttatatcttattatctgttgggaaaa  c.1746+1080

         .         .         .         .         .         .  g.61270
ttagctactgatcttggacttgtgacatacatcttttttttcttttaatcttaacacacg  c.1746+1140

         .         .         .         .         .         .  g.61330
tgtcctgtttgctaaggattgcaacgtggacatcttgctctattttgaaataatgttctt  c.1746+1200

         .         .         .         .         .         .  g.61390
ctgttctcattcagcgcttttgccaaggttctaattccatctacagtgatttccagtttt  c.1746+1260

         .         .         .         .         .         .  g.61450
cttagaggcatgacattagcacgaaaacaagctgtattataatggttcatgataacagaa  c.1746+1320

         .         .         .         .         .  g.61500
tatgatttttccaagggaaatgatagcaaattgtagatttccttctttat  c.1746+1370

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.61550
          ctcttgagtatatagatgaccttttacattaatgaggaagaagtgtcatg  c.1747-1321

.         .         .         .         .         .           g.61610
ttggcatgcaaagtaatgatgttcaaaaccattgctttagcacacacaaaagaaaaaaac  c.1747-1261

.         .         .         .         .         .           g.61670
gacaatctggagtaagccttttctctttttaaggttatttttgtggataattgctaatat  c.1747-1201

.         .         .         .         .         .           g.61730
attgtttcttgtgctgacagtgctttgttgagggtgtaaggggaaagaaccattgggtat  c.1747-1141

.         .         .         .         .         .           g.61790
gtgtttttcattttgttttgttttttggtcatctcctgtaagatatagaagataaacgat  c.1747-1081

.         .         .         .         .         .           g.61850
agcatactgtaggttatcctatcatttctgcttaattccaattgaaaggaatctagcaaa  c.1747-1021

.         .         .         .         .         .           g.61910
aattttggaattcatgaattgtctaaaaattcaattttatcacttttcaggaaatagata  c.1747-961

.         .         .         .         .         .           g.61970
acttgaaccactcacagaccaagcatttccaaacaaacattttacttagggatctgttct  c.1747-901

.         .         .         .         .         .           g.62030
tagaagtacagatcaccctgcaatcaggagcagtcattcgttactgattatattcaagtg  c.1747-841

.         .         .         .         .         .           g.62090
tgattcttgtgttccttggatatagtagtctagtaatgaactttagcttaatttttggtc  c.1747-781

.         .         .         .         .         .           g.62150
aatttgccagatttcagaggagcagagcttttttctttgtcacactcaaagataccaata  c.1747-721

.         .         .         .         .         .           g.62210
gttgggttagacccctggggggttagttttggaaaaaggacaccggttctgcagagacca  c.1747-661

.         .         .         .         .         .           g.62270
aaccagccactcatgagatgacataagttataataccttttctgtttttcattctctctg  c.1747-601

.         .         .         .         .         .           g.62330
aaaccatgactttgcaatagttgttatctgggaagtattagttgaggaatggggattgtt  c.1747-541

.         .         .         .         .         .           g.62390
agttacaaatgaccaaaatcaagtctgcctgatttaaataaaaagggaatgtattgatag  c.1747-481

.         .         .         .         .         .           g.62450
gatactgggcaactcatcagatctccagggtttctgaagaacctgactcagggctatccc  c.1747-421

.         .         .         .         .         .           g.62510
caatattatgctctacaactggtctagtgaggacaggctgtggctgggagcaggcagaag  c.1747-361

.         .         .         .         .         .           g.62570
tttgacagagccattaccgctttcctggcattgttgccactgtggtctgccctgcaccgg  c.1747-301

.         .         .         .         .         .           g.62630
tgcacctgttggtttccacacccttgcacttctagctcttaactcacaaccttggtgatg  c.1747-241

.         .         .         .         .         .           g.62690
tatctggttgctggagctgaggtttgtgcctgtatcttagctaccagggaggcagcattt  c.1747-181

.         .         .         .         .         .           g.62750
tcagtttctttagtgggaggtagcctctcacctcccaccaacactcattaggtagtgaaa  c.1747-121

.         .         .         .         .         .           g.62810
tttccaaacacagaataaggtttcacatgctgggcagcaaaaactgctgagaaacgtcca  c.1747-61

.         .         .         .         .         .           g.62870
gtacaggactgggggaaggtcttaacatgaaaccgtgacatgattttccctcctttgtag  c.1747-1


Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center