SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2) - 2605 nt intron 12 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.63342
gtatgtatgtatctctgtttggggtttattggtttgaaagttatcagaggaagaaattct  c.1935+60

         .         .         .         .         .         .  g.63402
tcctgaatgtaagcccgggccttgggtccttctatcatttcttcctccaggattggcctt  c.1935+120

         .         .         .         .         .         .  g.63462
tgggtgacagctggggctaaggatttacaaatgctttgatggtgtatgcctagtggtaca  c.1935+180

         .         .         .         .         .         .  g.63522
gtgatctcttggaaggccctggctaatggggaaacctggcacattctaaattcacttgaa  c.1935+240

         .         .         .         .         .         .  g.63582
accaagagaagagaagctggcattaacttgggagatggtgaagtggtcttttgggggaga  c.1935+300

         .         .         .         .         .         .  g.63642
attggagatggattaccttgggaaaggccataccatacctctaagtggttcacattgaga  c.1935+360

         .         .         .         .         .         .  g.63702
attaactgccaaaaagttctgaagtccttcagaccttcgagtctatttgcaattctgagt  c.1935+420

         .         .         .         .         .         .  g.63762
ctggaaactttgacaaaaagggcaacgtgggcttggtttaatgagtttattgatcctctt  c.1935+480

         .         .         .         .         .         .  g.63822
gatttctctccaaatgtgattcttgtttgaattccttagatatacttgttatccaaagag  c.1935+540

         .         .         .         .         .         .  g.63882
aagcgctcagtctcttggaaggaatacttagtataactagaacctaaaatgggaatcttg  c.1935+600

         .         .         .         .         .         .  g.63942
ggtatttttaatagaaattgagaaataataaaatatttgttaaatcagccacaaaatgtt  c.1935+660

         .         .         .         .         .         .  g.64002
taatttaataattacaaatagaaggattaaaagaagatttgctctcctttattagagcat  c.1935+720

         .         .         .         .         .         .  g.64062
tgttaatatattgtcattagatctgatatttttgagagtgccgtagtataggtgccgagg  c.1935+780

         .         .         .         .         .         .  g.64122
acaaggtaaaacatccttacccataatagcttaccagggtctcaagactatggctgtttt  c.1935+840

         .         .         .         .         .         .  g.64182
ccttctatttgtggacctgtgttttccaaattagtcttccatgagcacttaatgcttttg  c.1935+900

         .         .         .         .         .         .  g.64242
taaagagaaagaataataaaagttacattacaaaaaagcataatcattaaaaagcaaaca  c.1935+960

         .         .         .         .         .         .  g.64302
tggttgggcatggtgactcatgcctataatcccagcattttgggaagctgacgcaggaga  c.1935+1020

         .         .         .         .         .         .  g.64362
attgcttgagtccaggagttcgagaccagcctgggcaacatggtgaaaccccatttctac  c.1935+1080

         .         .         .         .         .         .  g.64422
aaaaaacacaaaaatcagcggggcgtggtgacgcatgcccgcagttccagctactcggga  c.1935+1140

         .         .         .         .         .         .  g.64482
ggctgaggtaggaggatggcttgagccctgggcagagactgcagtgagctgaggtcgtgc  c.1935+1200

         .         .         .         .         .         .  g.64542
cactgcactccagcctgggtgacagagcaagatcctgttttgttgtgttttgttttttaa  c.1935+1260

         .         .         .         .     g.64585
aagcaaatactttttgggggatgctatttgtttcccccagcta  c.1935+1303

--------------------- middle of intron ---------------------
     g.64586        .         .         .         .           g.64627
     c.1936-1302  ctctatctctaagatatttaaaggtgtcttgtttacttggat  c.1936-1261

.         .         .         .         .         .           g.64687
gaatgggcttataagtgacctactggaagaagcttctctttgaataagagagccagagag  c.1936-1201

.         .         .         .         .         .           g.64747
ggcagagataagatgaagtaggccgcctagccagcaggtgccatcctgagaatgacaagc  c.1936-1141

.         .         .         .         .         .           g.64807
acagacagcccttgtccctgggcccatcacatgggtctgctgcaggtgagcctgagtgac  c.1936-1081

.         .         .         .         .         .           g.64867
atgtggagagtcatgtcccctctcagcgttttatttcctggcctggaaaatgaaggagtt  c.1936-1021

.         .         .         .         .         .           g.64927
gtgccaaggccttagctgactccctgcttctaaatgatctgctatcataaggtttgattt  c.1936-961

.         .         .         .         .         .           g.64987
ttctccttgatagtttgtcaattcatactttgtcatttaagagttatggaaaagcatagt  c.1936-901

.         .         .         .         .         .           g.65047
tctctttaaacctgcttttcaaggaaattctactggattgtctggaaagatttagccttc  c.1936-841

.         .         .         .         .         .           g.65107
tacaccaggttagtagtggacagaatggacacttacttagtgatgctttcaaatgggtca  c.1936-781

.         .         .         .         .         .           g.65167
gctggatgtagcactcggttgagaagggagaggtattgaatccttcgccaagttattgag  c.1936-721

.         .         .         .         .         .           g.65227
agtttttaatctcagtactctgcaatgtgtgatgtgaatcagccacagaaagcagtgtgt  c.1936-661

.         .         .         .         .         .           g.65287
ttacaagatccaggtcctctacagtggacatatatggggccatccaagtcccatgggcat  c.1936-601

.         .         .         .         .         .           g.65347
tatcagagagagtagattttttttgttttgttttgtgttttgttttgagacagagtttcg  c.1936-541

.         .         .         .         .         .           g.65407
ctcttgttgtccaggctggagtgcagtggtgtgatcttggctcactggaacctctgcctc  c.1936-481

.         .         .         .         .         .           g.65467
ctgggttcaagcgattctcctgcctcagccccccgagtagctgggattacaggcatgagc  c.1936-421

.         .         .         .         .         .           g.65527
cactgcacccagccatcagagagagtgtttttatgagaaggaggatcctaagagctctac  c.1936-361

.         .         .         .         .         .           g.65587
aatctggctttggagagagtgctactgagtgagagcagatatgctctacaggactctgat  c.1936-301

.         .         .         .         .         .           g.65647
aaccaaataatgataaacatttatgtttctggcatgatatttacatactcattcttggga  c.1936-241

.         .         .         .         .         .           g.65707
gcaagggttctaggggatcctcagagagttcccttcattatctcattcatgatttcaaca  c.1936-181

.         .         .         .         .         .           g.65767
gcagttgaattgggggtattaccttacttaagtagatgttacatttacttcctccctgaa  c.1936-121

.         .         .         .         .         .           g.65827
ttttatgatcttacttcatttgtgaagttcaatactagtttatgtcttttcagaaaatgt  c.1936-61

.         .         .         .         .         .           g.65887
caatcatagagatttccttgttaaaatataatttcctccctatctttgttccttttccag  c.1936-1


Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center