SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2) - 4055 nt intron 14 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.67495
gtaattggcatggtttcagtttccttggcaagttgtaaccatttacctaattttgattga  c.2184+60

         .         .         .         .         .         .  g.67555
agtatgtcgtgcacatgttgactaagggcttttgatgatattttaggccacatcacttat  c.2184+120

         .         .         .         .         .         .  g.67615
aatactgaggttcctttcattgtgcctatgattcttcttttagagtactccatgttacca  c.2184+180

         .         .         .         .         .         .  g.67675
tctttactagggcatgccatacccattttctcttttatgcttttgggatgtattttaagt  c.2184+240

         .         .         .         .         .         .  g.67735
gatctctgcaaaatggaaaacccagccacattctattaaactggagaacatccacgcctc  c.2184+300

         .         .         .         .         .         .  g.67795
atcttgaagtatttctttaaaatttttaggtgtggctgtggttttatgccgtggattgaa  c.2184+360

         .         .         .         .         .         .  g.67855
cccacctaggagtagctgtctactacatttatgctttttcttaagacacaataggccagg  c.2184+420

         .         .         .         .         .         .  g.67915
catggtggctcactcttgtaatcctatcactttgggaggctgaggtgggtggatcacttg  c.2184+480

         .         .         .         .         .         .  g.67975
aggtcaggagctcgagaccagcctggccaacatggtgaaaccctctctctactaaaaata  c.2184+540

         .         .         .         .         .         .  g.68035
caaaaattagctgggtgtggtggcacatgcctgtaatcccggctactctggaggctgaag  c.2184+600

         .         .         .         .         .         .  g.68095
caggagaatcgcttgagctccggaggtggaggttgcagtgagccaagatcttagcactgc  c.2184+660

         .         .         .         .         .         .  g.68155
actccagcctgggtgacaaagtgaaactccatctacaaaaaaaaaaagaaacaataaaat  c.2184+720

         .         .         .         .         .         .  g.68215
tgtgagcatctgtgctttgattaaaaattaggccattgttttatttgacctgtctggatt  c.2184+780

         .         .         .         .         .         .  g.68275
gaggctaattccctgtgttctaccttctaccacttagtgacgtttcccaaattgtgttcc  c.2184+840

         .         .         .         .         .         .  g.68335
atgagacatttgttctatgaattgttccttaaaaattaaaaaaggaggccaggtgcggta  c.2184+900

         .         .         .         .         .         .  g.68395
gctcacgcctgtaatcccagcactttgggaggctgatgtgggccgatcacaaggtcagga  c.2184+960

         .         .         .         .         .         .  g.68455
gattgagaccatccttgctaacacagtgaaaccctgtctctactaaaaacacaaaaaaat  c.2184+1020

         .         .         .         .         .         .  g.68515
tagctgggtgtggtggcgggcacctgtagtcccagctactcgggaagctgaggcgggaga  c.2184+1080

         .         .         .         .         .         .  g.68575
atggcgtgaacccaggaggcggagcttacagtgagccgagatagcaccactgcactccag  c.2184+1140

         .         .         .         .         .         .  g.68635
cctcggcaacagagtgagactctatccaaaaaaataaataaataaataaaaataaaaata  c.2184+1200

         .         .         .         .         .         .  g.68695
gataaataaaaaaagaggtttgtggccaaatactgtaactaagattaccatataaattac  c.2184+1260

         .         .         .         .         .         .  g.68755
tatttctaacttgaatacttgtgaacgtgagtcgagggccttattattgataataggcat  c.2184+1320

         .         .         .         .         .         .  g.68815
aaccctggactgtccctgaacaacaaccagatacggtcactctggcagtgacccctcttg  c.2184+1380

         .         .         .         .         .         .  g.68875
ttaattcacatgcccgtcagcacacttgggactctgcggaaatcaacatgtaaccataag  c.2184+1440

         .         .         .         .         .         .  g.68935
gcacatcagcatcctgcagtaaaatcacttctttaacattgtttaacttcatatttccca  c.2184+1500

         .         .         .         .         .         .  g.68995
aatttctttgactaccaaaccctatttttatatcaccaattaacatcctgtaagactagc  c.2184+1560

         .         .         .         .         .         .  g.69055
gtcttctagaatacactttaggaagtgtacttgttggcatcgggtcctctctactcttaa  c.2184+1620

         .         .         .         .         .         .  g.69115
cacttggtactgtgtctgctgcccttgcataggagtgcagaatacaatgactgccagtac  c.2184+1680

         .         .         .         .         .         .  g.69175
agtactgccttgatggtgctgaagcactagcagtttttacctaccaatgcttttgcatca  c.2184+1740

         .         .         .         .         .         .  g.69235
tcagtgcagacgtcaacacagtaaaaatgacaagtaatgccttagtattgtcatgctaat  c.2184+1800

         .         .         .         .         .         .  g.69295
cattttgacctcgtggatctccttccaagatcttggggggccctgagaacccctggaaca  c.2184+1860

         .         .         .         .         .         .  g.69355
cattctgaggaccactgctctggccttagtaagatcatgttttctccaaagaccatgtca  c.2184+1920

         .         .         .         .         .         .  g.69415
tagtcctgagatccaaagcaggtttcatcttgtttggcctacctgacatagatgttaact  c.2184+1980

         .         .         .         .          g.69463
catagcatgctctaataaacttttgtatatctgcatatgggagatcca  c.2184+2028

--------------------- middle of intron ---------------------
g.69464             .         .         .         .           g.69510
c.2185-2027  tcttttgaattatttgtgaataacttgtaatgccacatgggttttct  c.2185-1981

.         .         .         .         .         .           g.69570
tctgtcatccaacacccttctaagcagtcttcatcactctcttttcaaacctagctcctt  c.2185-1921

.         .         .         .         .         .           g.69630
cgacttccatatgtgagttttatgcctctgtgttgctgagctgctgtagattccccgaac  c.2185-1861

.         .         .         .         .         .           g.69690
atgccttgcagtgtctctctggatttataccttatgaagtgccttcttcctggaatcttg  c.2185-1801

.         .         .         .         .         .           g.69750
actagccatgtccgcctgatgagatctcacaaaccagttcaagttgtggctcaaaccttc  c.2185-1741

.         .         .         .         .         .           g.69810
cctgatcatttctcataaaccagttcaagttgtggctcaaagccttccctgatcattctc  c.2185-1681

.         .         .         .         .         .           g.69870
tccatgagtaagctttctatcttcttgcttcttgacaggtttttgtgtcattaatattta  c.2185-1621

.         .         .         .         .         .           g.69930
cttaaccttgacacggctgaggtcttcctgctactcctagagagccacataagcttggtt  c.2185-1561

.         .         .         .         .         .           g.69990
caatatctaatcctccccctggccaattctgccagtttccagcctgagaaaatccaaatt  c.2185-1501

.         .         .         .         .         .           g.70050
acttcccacaatttttgtgaatttctagtctcctctgctgctagtttctacttctgtttt  c.2185-1441

.         .         .         .         .         .           g.70110
gtattgaattagcacaaacgcaaaattcagcccctttaccaattttctctaaaaaaagca  c.2185-1381

.         .         .         .         .         .           g.70170
gaaacaaaaattcatcctacagagtatccaaaatgtttcttgtatttagttgacttttct  c.2185-1321

.         .         .         .         .         .           g.70230
aaagctctagtggtttcagggtcacgttgcaggctgacagcttctcctgtctaccactgt  c.2185-1261

.         .         .         .         .         .           g.70290
ttgttttataataatttcccctctttccctctatcttttgcccattctcttggaggttct  c.2185-1201

.         .         .         .         .         .           g.70350
tcctgtttctctacttatctcttgttgttgttgtagttctgcagaaacctttaggatgac  c.2185-1141

.         .         .         .         .         .           g.70410
tttggaatcttgcatggtacaaagtatctcaagtggcttatggaagtattgcttcaaacc  c.2185-1081

.         .         .         .         .         .           g.70470
aatgcggtgtctccctaagaaaaattcttgtcaatacagttttatatgtatacatataca  c.2185-1021

.         .         .         .         .         .           g.70530
ttggcactgtcaaccacttcttggcatatgtgtatatgtgcctcattcattgttttctct  c.2185-961

.         .         .         .         .         .           g.70590
tttatttgagcttctgaagggaggcatgcatcttacagaccttggtatctatctgctaca  c.2185-901

.         .         .         .         .         .           g.70650
gctccttgcatggccccttgcacagaatagtcatttaataaatattttaaataaactaat  c.2185-841

.         .         .         .         .         .           g.70710
tgcttgctttgttcttacataaaaaattaacatttccctaagcataacatcattagcaag  c.2185-781

.         .         .         .         .         .           g.70770
ctaaattgactttagcaaacatatatataattgatcctatcatttaaatccagcatctgt  c.2185-721

.         .         .         .         .         .           g.70830
ggtatgatggtggaagggaattgttggttgggggatggaggtttaacaattttgtatttt  c.2185-661

.         .         .         .         .         .           g.70890
cacccaaccttacttttgtacttaacgtggggaatctctggtacagtgtttttgtacttc  c.2185-601

.         .         .         .         .         .           g.70950
agaaatacgttgagcatgtttccagttgccagcttccagtgtgcagcctttgggtagtac  c.2185-541

.         .         .         .         .         .           g.71010
tcacattacaaagttcccatgtgctgtctgggaactttctctctgccaggaagagaaatg  c.2185-481

.         .         .         .         .         .           g.71070
tcctcctgtggtcccagcagagtgtccctggctccctggtcagtccgccttttcactgag  c.2185-421

.         .         .         .         .         .           g.71130
gggacctcacccatattaccgaaaaggctgtttttaataatctgtgatctgtgtgccaaa  c.2185-361

.         .         .         .         .         .           g.71190
tctgccttcacattggctttttattcttggagtggttggattagattttggtttgggctt  c.2185-301

.         .         .         .         .         .           g.71250
ttttcatttataataattctagaatgtcacatactgtgaaatactaagtgtggatgagcg  c.2185-241

.         .         .         .         .         .           g.71310
gcaaagctgctttaaaactcacctgtcaagaagcaagaagagagaaagcttactcatgga  c.2185-181

.         .         .         .         .         .           g.71370
gagaatgatcaggctcatattttacattctttttgcattggtgcttcccccattttccta  c.2185-121

.         .         .         .         .         .           g.71430
ctgtgggaaacccaacatacagcagtgaggagttaagaagtcacaccctcacttgggttg  c.2185-61

.         .         .         .         .         .           g.71490
tattaggattaattacctgtgcagatcttggataattgaagcaattactcttcatttcag  c.2185-1


Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center