SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2) - 1351 nt intron 15 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.71714
gtaagtaaagtcatttattccacagtcatcgttctgtatgttgtagagtgcccgattagt  c.2348+60

         .         .         .         .         .         .  g.71774
agcttgtccttgttttttacttaagacagaattgtagcatgtactaacctaaatccagat  c.2348+120

         .         .         .         .         .         .  g.71834
taccaagagcatgtaatctggatttaggttttaatttcccacccctccccatcctagcct  c.2348+180

         .         .         .         .         .         .  g.71894
gtttgattggctatttaagcacgggaccgagtgattttatcggccatcagcattacaggt  c.2348+240

         .         .         .         .         .         .  g.71954
ctgcacagcctgaacactgcatagtgagtcttgctcatcattattccttaagtggctcac  c.2348+300

         .         .         .         .         .         .  g.72014
aaaggggaaaggtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgattt  c.2348+360

         .         .         .         .         .         .  g.72074
ctttgattttttccttattccatttccaaaagatgatatattcttaaatcttccttttaa  c.2348+420

         .         .         .         .         .         .  g.72134
aagcagaacataaatcaaaatcataactaggagttttgcattaaaataaccttagtatgt  c.2348+480

         .         .         .         .         .         .  g.72194
gcactgaggttatgtttcaatgagtttgctgcttagtaaggacaggagtttgctgttcgc  c.2348+540

         .         .         .         .         .         .  g.72254
cattacgttcccagtgcctcacctgctaggtggttcttagaaggtcctaagtgggcacta  c.2348+600

         .         .         .         .         .         .  g.72314
ccgagtgagggcacagtgattcacaagcaccctcctgggagttcagtgtgtctgcctgtg  c.2348+660

         .        g.72330
ggtgttaggttgcagt  c.2348+676

--------------------- middle of intron ---------------------
                                 g.72331          .           g.72345
                                 c.2349-675  tttgttcaccaaggt  c.2349-661

.         .         .         .         .         .           g.72405
cttgttatagatctcaatgctgatatgaacttggaccttcagtaagaagaaggattctat  c.2349-601

.         .         .         .         .         .           g.72465
taatattattgtgttttctttgaattttttctaatgaagactatttgcagccctttttgt  c.2349-541

.         .         .         .         .         .           g.72525
atgaattatctgtatctgtaatatttaggcatcttttgcatttgatctatattttgcgtg  c.2349-481

.         .         .         .         .         .           g.72585
ttctgaatcatatatacagtgacactttcagggctttaaaaaacgtcattcaatatttct  c.2349-421

.         .         .         .         .         .           g.72645
tcccctgttccctcttgacagatttattttatgttttcatgtggttttataatttctttt  c.2349-361

.         .         .         .         .         .           g.72705
tcctgactcatcttttttctgaacctatatggctgtttatgaagattcctaaaatcattc  c.2349-301

.         .         .         .         .         .           g.72765
tggcaattgctcttttttaatatcatattacagtttagttttttgctctctatatttatg  c.2349-241

.         .         .         .         .         .           g.72825
tattctttagtttttttcttacaagatttttttatgaaccacaaacttgtcatgttttgt  c.2349-181

.         .         .         .         .         .           g.72885
gacagtttgttttgaacttatctcctatttccacacctttaaaataaatatcttgttgag  c.2349-121

.         .         .         .         .         .           g.72945
atatgttatattctgtagcccctttcaaggtgaggcctgaacatgaataagaacatcttt  c.2349-61

.         .         .         .         .         .           g.73005
ttaaccattgatttttatacaaatgtcttttttctgttgttttttttttttgttccatag  c.2349-1


Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center