SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2) - 2632 nt intron 17 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.73915
gtatgtttttaaaaaattattttctctctaattaggaccattgcactggaatgtgaagta  c.2526+60

         .         .         .         .         .         .  g.73975
ttgcccaagtcagtagtgtaattggatccttagatggcttgtccttttctttatttttct  c.2526+120

         .         .         .         .         .         .  g.74035
aaaattttttcagagtttgatatgttttggtcgtggatttgatttcatgcatgctgtgtg  c.2526+180

         .         .         .         .         .         .  g.74095
tgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtttatgattgatcctggggc  c.2526+240

         .         .         .         .         .         .  g.74155
ggctcttgtctatcccctcagagttgatgagtttacatctcttaaaaaaattcacctggt  c.2526+300

         .         .         .         .         .         .  g.74215
tgcttctgcaactctttttctctctaacagctttgcacattctcgggaaagaaataattg  c.2526+360

         .         .         .         .         .         .  g.74275
tttttgttgccctgagatattgtcagtgtaccttcattcttcttgtgcctttgtttctcc  c.2526+420

         .         .         .         .         .         .  g.74335
aaagatgagccagacacctctccatatggtctccaccatatgaacatttatccaagccgt  c.2526+480

         .         .         .         .         .         .  g.74395
ggcttttgtggtagtcttgtttcaggtttttcctggtgaaataatagactatcattgttg  c.2526+540

         .         .         .         .         .         .  g.74455
gagttacttaaggttgtttctgtgactatttatttgaaactgagaaagaggtgtttctgt  c.2526+600

         .         .         .         .         .         .  g.74515
gacttacatgtctcctaatttttatgtcctaagttgttccttagccacaaagtagaaatt  c.2526+660

         .         .         .         .         .         .  g.74575
tttactcccatttatatcatcttgtcttctaatacgttcatgtagaaagatggaagtgct  c.2526+720

         .         .         .         .         .         .  g.74635
ctctttcgtggaacaaataatgaaaactcttttttttcctctttagtaattttttttacc  c.2526+780

         .         .         .         .         .         .  g.74695
ccatgacgttttgaaagcactataatctgaaactaagttatgtccaaaattgaatagaac  c.2526+840

         .         .         .         .         .         .  g.74755
ctctatttctggggtctattctacctctgcattaaactcttgctctgggaactgagagtt  c.2526+900

         .         .         .         .         .         .  g.74815
cccttcatggcatcataggaaataacaaaaaggaaatgtgttcccaggggaggtttaata  c.2526+960

         .         .         .         .         .         .  g.74875
attgagatggcactggcaacaatgctgtgttccacctcctcacactcagagatgaatttg  c.2526+1020

         .         .         .         .         .         .  g.74935
gcagtgtcaaaaatgatgtgttttcaatattactatgggaatgtgtttgtacatttgaga  c.2526+1080

         .         .         .         .         .         .  g.74995
tccttttaaaaaaattcatcttgtgtcttctgcatatgtatttcaagattcattggagac  c.2526+1140

         .         .         .         .         .         .  g.75055
gcctggtaatgagatgcactgcttttatttgttactggagaaatggagctatagaaagag  c.2526+1200

         .         .         .         .         .         .  g.75115
gtagtaattttgtccaagtggaagacctaattagtagtagaccccatagcaaaatcaaag  c.2526+1260

         .         .         .         .         .        g.75171
gcctctgattctttattatttcataagctaaattaggcaggaaagtagatttagga  c.2526+1316

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.75227
    tatttatttaaatatattttttgtctgcttgcctcttttcatgctgttggtaagtc  c.2527-1261

.         .         .         .         .         .           g.75287
tgaggcagttgattgtacagctttaattatccttaaacacttttcttagaggtggtggag  c.2527-1201

.         .         .         .         .         .           g.75347
gaaggaaaaaaaatcgaggtagttttttttttgtttttttcttacctgtacatcccagcc  c.2527-1141

.         .         .         .         .         .           g.75407
tgactgatgattttattccttttctcctggcacgtctgatgcttctaatgaggaaggcaa  c.2527-1081

.         .         .         .         .         .           g.75467
ggactgtatagaatactttcctcatctcccttctctctctaggagctttgcagcaggatc  c.2527-1021

.         .         .         .         .         .           g.75527
tggggacatctgagcaccagatgtttttcttggccattgccactgttttgtagagaatgg  c.2527-961

.         .         .         .         .         .           g.75587
ataggcttagtggaacattcctcattgttctcactttaagaaactgaacagtgctcttaa  c.2527-901

.         .         .         .         .         .           g.75647
gaggactgaagggtaaggtatgagagagggaacgtactgtgtagacaggaaggaggactg  c.2527-841

.         .         .         .         .         .           g.75707
ggccatataagcattctggacgttttacgcaatcgtcatgttggggaagtatgctgtatt  c.2527-781

.         .         .         .         .         .           g.75767
taattctgcagttttggcataaatacaggagtgatatttttgcagtgcgctttctgccag  c.2527-721

.         .         .         .         .         .           g.75827
tgagtatattcttttattttagataaaacaggggtcctagatctggcaggtaaggaatgt  c.2527-661

.         .         .         .         .         .           g.75887
gcgtgtattgagggagcttcgttgtcagacctaatttttgaaaagccgtatgtacaaatt  c.2527-601

.         .         .         .         .         .           g.75947
taatgtgaaatagtccaacttttaaatgttagcaaccagtccaaacaaaacaaaacacac  c.2527-541

.         .         .         .         .         .           g.76007
ttccgggccaagccctaaaggtagtaaccagccaggctaatagaaaagaaggcatggagc  c.2527-481

.         .         .         .         .         .           g.76067
caagaatatctcagctgtagaacctgctagggccatcttggaaaaatcagtcattaacct  c.2527-421

.         .         .         .         .         .           g.76127
ctgcttcaggtgggtacctatattctgtgcctgtcatgagctgaaatagcatgaccatga  c.2527-361

.         .         .         .         .         .           g.76187
aatctgggatagctgtcatgataacgtattaatagaaggggcattggatggggagaggca  c.2527-301

.         .         .         .         .         .           g.76247
ggatccacacgtggaaacaaccatgtcattctggacccaaatttccttctttgtaaaaag  c.2527-241

.         .         .         .         .         .           g.76307
ttgatttggaattacgtggtctgtaaggaacattgttcctttaacattctattattatag  c.2527-181

.         .         .         .         .         .           g.76367
gatgtcttatgcggcctatcaggcatgagacattgttgagattcccttgtctcaaaggta  c.2527-121

.         .         .         .         .         .           g.76427
atcacagcatatcatataccaaggatgggttctttggttttccgcaccaccacttgcttg  c.2527-61

.         .         .         .         .         .           g.76487
ttggaaatagttgtattttcccttgcttactacacgtccgtccttcctcttgtgttatag  c.2527-1


Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center