SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2) - 8043 nt intron 19 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.78332
gtatgttgcacaaccaaaagttgtgggttttttttttcctccagcaaatatatttgaagt  c.2883+60

         .         .         .         .         .         .  g.78392
acctgcctctgaaattgtgtttctgaaacagcagactcatattgtagttaatagtatctt  c.2883+120

         .         .         .         .         .         .  g.78452
gaaaatatcttaaattgtttttttgtttgatagggctagagagagcagggaaattatagc  c.2883+180

         .         .         .         .         .         .  g.78512
atttgcagcctgttttccaaaagcgttcgagcagattttatgaaattatcaaattcactg  c.2883+240

         .         .         .         .         .         .  g.78572
agtctcatttacattttaattttagatttttttttttttttaaattacggacctcattga  c.2883+300

         .         .         .         .         .         .  g.78632
gttcactgttgcaggcactgtagaattgttctgcttataagtgaatggaagatttggcgt  c.2883+360

         .         .         .         .         .         .  g.78692
tggggacttgtatcatcattgaagggggtggtaaacatttacaggttttctagaaattta  c.2883+420

         .         .         .         .         .         .  g.78752
tttaacatttgatgtttgtgatgtcaccattctgacagtaagtgaaaaaacagagttcct  c.2883+480

         .         .         .         .         .         .  g.78812
gcaaattacagacacatcatctaattattcggggacattatttttgttctgtgccataaa  c.2883+540

         .         .         .         .         .         .  g.78872
aattaagttcctgtgaacattttaagccagtatttttcggactaacttttggaaacttag  c.2883+600

         .         .         .         .         .         .  g.78932
tctgcagtactttagaacaccttttgagcccttagctccatgttttggggttggatgtga  c.2883+660

         .         .         .         .         .         .  g.78992
gtattagtttaatatgtttctgatcatattttggaaccatgcatatttgaattctaagtt  c.2883+720

         .         .         .         .         .         .  g.79052
tcattctcttagagacagtttagcattgtgtactatttgttgcatgaggtattttgattt  c.2883+780

         .         .         .         .         .         .  g.79112
gagttttttctttagaagagccaattctgaaatgtcttatttttgcatgattgtggtttt  c.2883+840

         .         .         .         .         .         .  g.79172
tctgggtaacgactctatttttggacagattggttcatcctgttcatttttaagtgggag  c.2883+900

         .         .         .         .         .         .  g.79232
ttttcaagatggtgtacaacgttgatcactttgttacgagagaattttattccctaatcc  c.2883+960

         .         .         .         .         .         .  g.79292
tttatgcattgtcagaaaaaaaattaaaaatgacttttataccatgcatatctcagtgaa  c.2883+1020

         .         .         .         .         .         .  g.79352
agtctacgtatttaagtattttattctgctggtgaatgcatcttggacgtagaatgctat  c.2883+1080

         .         .         .         .         .         .  g.79412
tgatattcccttggacttcctgtggtcttggcctctgggtagcaccctttctgttcaaga  c.2883+1140

         .         .         .         .         .         .  g.79472
tggagtttagttactgagtagataaattgatgaatgggtatagtggccatgtgggtgcct  c.2883+1200

         .         .         .         .         .         .  g.79532
tgaattacttcctagcatacagttacggtgattctgcaagtgatagagatggaatgttaa  c.2883+1260

         .         .         .         .         .         .  g.79592
acattttaatttatcccataatttctttttttttctttacaagaggtataaaataaaagg  c.2883+1320

         .         .         .         .         .         .  g.79652
caattaactgaagcccttcatttattcattccataagacttcttaatcttgttcattcac  c.2883+1380

         .         .         .         .         .         .  g.79712
ttctaagactggctaatacagatagatttttaaaaatatattgcaagttgaaagtatgtt  c.2883+1440

         .         .         .         .         .         .  g.79772
atgttgtaagaaaatccactagagaaaaattgaaatttttgcagcttaagaattatgagg  c.2883+1500

         .         .         .         .         .         .  g.79832
tgattaattatatcacaaaggaattctttgctttacaaaaatatttattttatggttctt  c.2883+1560

         .         .         .         .         .         .  g.79892
tctacaagagaagttcctgagtatacttgaaggatgataaaatttttatgaaatgtatct  c.2883+1620

         .         .         .         .         .         .  g.79952
accctcaaatgatcacgagtatgtctcttgcataaagtatacatgtatttattaacaccc  c.2883+1680

         .         .         .         .         .         .  g.80012
agagtattatatttgaggtatgtaaaatactcagtgtgtggtattatctacctttagagg  c.2883+1740

         .         .         .         .         .         .  g.80072
tatctgtacctttaaaggcagccatgttatcttttcctttggtggagtggaaatcatggg  c.2883+1800

         .         .         .         .         .         .  g.80132
ctctgcctgtcagagtaggcatgggtttcaccacattctccatctcttactatgtgaact  c.2883+1860

         .         .         .         .         .         .  g.80192
tgggcaagtcttctaacctaaatgggtcttagtgttctcatcagtgaactggaagataaa  c.2883+1920

         .         .         .         .         .         .  g.80252
tgactctgtcttatggagttgtgaggattaaatggatgtagggctcctaataccatgcca  c.2883+1980

         .         .         .         .         .         .  g.80312
ggcacatggtgggcacccaaccaatgacagctgcttctaccatattccttattttccact  c.2883+2040

         .         .         .         .         .         .  g.80372
catgttgctgtctctgttattaatgggagttccattttcctattcttgaagctctttctc  c.2883+2100

         .         .         .         .         .         .  g.80432
gctgttctcttgtctttgctctccttccggtagcccccccacatctctctccataaactt  c.2883+2160

         .         .         .         .         .         .  g.80492
ttcaagcactttgtgtgtgtatgtggttgttgttgatatggctgggctgatgttcatttt  c.2883+2220

         .         .         .         .         .         .  g.80552
ctactttttcagccttgttaggattttttttttttagcctggggaaagttggaaatttca  c.2883+2280

         .         .         .         .         .         .  g.80612
ttgccatcctagggggtaaagaagtttcttctaccaccactgcttacagccacaaacaat  c.2883+2340

         .         .         .         .         .         .  g.80672
gtgcatgtcttacttagcctggataaagaatccagaaaggaactacggcagatggaggaa  c.2883+2400

         .         .         .         .         .         .  g.80732
aaggctaaatactttcacagcagtaattctcaaatgtttttatgaaaaaagagccatata  c.2883+2460

         .         .         .         .         .         .  g.80792
ggaaagaggcttttacttttattttttaatttatgtgtagcaaaatttgcttcttttggt  c.2883+2520

         .         .         .         .         .         .  g.80852
gtatagttttatgagttttgacaaatgaagagttgtgttaaccatgcccacaacaaaaat  c.2883+2580

         .         .         .         .         .         .  g.80912
tcaaaacaatgtcatcatccaccgctccaaaaaaaattccctggtatttcctggtactac  c.2883+2640

         .         .         .         .         .         .  g.80972
ttcttttcagtgaaaccctccctcggctcgtagcctcatgcagccactcatccgttctcc  c.2883+2700

         .         .         .         .         .         .  g.81032
atccctgtctatagctttatcttttccaaaatgtcgtatgagtagaataagacaatgtat  c.2883+2760

         .         .         .         .         .         .  g.81092
aaccttttgcatggttttttttaatttggcaaaatgtgtttcagattcatccatgttgtt  c.2883+2820

         .         .         .         .         .         .  g.81152
gcatgtatcaatagttggttcatttttattgttgaataatattccattacatggatgcag  c.2883+2880

         .         .         .         .         .         .  g.81212
cgcagtttgtttgacatttgggtcatttctagtttttgacaattatgaatagagctgcta  c.2883+2940

         .         .         .         .         .         .  g.81272
taaacttttcatgtacaggtttttgtgtgaacataggtttgcatttcacttgagtaaacg  c.2883+3000

         .         .         .         .         .         .  g.81332
ccttaggtgtatgactggttgatcgaatggtcagtgtatacatagatttgtaagaaactt  c.2883+3060

         .         .         .         .         .         .  g.81392
ctgcattgtttcttagactgtctgaagcactgggtagtcccaccagaaatatatgaccat  c.2883+3120

         .         .         .         .         .         .  g.81452
tccacttcctccacattctcattagtgcttgctattgtcagtttttcaagatttttagcc  c.2883+3180

         .         .         .         .         .         .  g.81512
attcaataggtgcatagtggcgtcttgtaactttgattggcattctctaatgtctaatat  c.2883+3240

         .         .         .         .         .         .  g.81572
tgttgagcatcttttcatgtgctttctcaggtgaaactaaagcaggtatataaaggccac  c.2883+3300

         .         .         .         .         .         .  g.81632
ggttttgtaaatgcaggtcaaccgcataggaaaattagctttaatattggtctaatgaaa  c.2883+3360

         .         .         .         .         .         .  g.81692
cacttaatgagcaagggaatatacccaccccccaaccaccaacaccgctaagctgttgtc  c.2883+3420

         .         .         .         .         .         .  g.81752
ataaaatccatttcttatgcacgggaaagaatgccaaatagaaaagggattatgtaagaa  c.2883+3480

         .         .         .         .         .         .  g.81812
caacttaagctaaataaaaattgatttttctatttagctcacatttaaggttgtctgtgc  c.2883+3540

         .         .         .         .         .         .  g.81872
tgactcttttgttaattcatatcatcaagaaccaactatacttgcaattggctgggtatt  c.2883+3600

         .         .         .         .         .         .  g.81932
tctttatgtctaaatatgctaaaatatgtatataatatctgaggttaactagaggttgac  c.2883+3660

         .         .         .         .         .         .  g.81992
ctacctaaagtcaatcctgattctgatataatttgtgaaaaacaccaacaaagctttgct  c.2883+3720

         .         .         .         .         .         .  g.82052
tacattggcaatttgtgtattcattatatcaaattttggaatgcttagcataattaatca  c.2883+3780

         .         .         .         .         .         .  g.82112
ttactttgttcctctctcatgccatagcgtttagaacctgagacttttcataaattgaat  c.2883+3840

         .         .         .         .         .         .  g.82172
catattgtttacaaatctcagttcacaaagtggtgatatatcgcatgtagtttaggttta  c.2883+3900

         .         .         .         .         .         .  g.82232
ttattccaataaaacatcctttaggaaggggaattataaatgaagaatagtattcaggca  c.2883+3960

         .         .         .         .         .         .  g.82292
gaagctatgaacaaagttcaaatacttctacaggggtatataagaagaaatgctgagcca  c.2883+4020

    g.82294
gt  c.2883+4022

--------------------- middle of intron ---------------------
                                              g.82295         g.82295
                                              c.2884-4021  a  c.2884-4021

.         .         .         .         .         .           g.82355
taatgacctgatttgcctacttttagggaccagttaggccatttactaacataagaatgc  c.2884-3961

.         .         .         .         .         .           g.82415
ttaggagataattaccagatacatgaggtcagcacctcagttttacatatgatttaaaca  c.2884-3901

.         .         .         .         .         .           g.82475
aaaatagctccagtggctctcacaaacctaacttactgggagaatcacccccgtgaagaa  c.2884-3841

.         .         .         .         .         .           g.82535
gtcacaagtttcatttgctatagcaccagtatattttgaggagctttcacatgcatgctc  c.2884-3781

.         .         .         .         .         .           g.82595
taaacagatgccatcacattttttgggggatgaactcagactcaaccgagttggagttgg  c.2884-3721

.         .         .         .         .         .           g.82655
cacgattattataaaaacttctctcgtcactgtgattcagtgtggtggctgtataattgt  c.2884-3661

.         .         .         .         .         .           g.82715
tcagtccatcccttttcttgatacaaacctgttgattgcctgctctgtacgttatactgc  c.2884-3601

.         .         .         .         .         .           g.82775
actcaggccaggtgggaggcacaatataccagaaatgggaggcatggtgtgagaagtcaa  c.2884-3541

.         .         .         .         .         .           g.82835
cagacttggctgtggagatgagggctactcacactgaataatagtgtggcaatgcaaggc  c.2884-3481

.         .         .         .         .         .           g.82895
agcatcatcccaccaatcagaatgaatgatccaggcattcaggtggtttaggacggggta  c.2884-3421

.         .         .         .         .         .           g.82955
cccagtatgtacacatgggtgtatgtgttgggaaatgcttattagtaatccattgggtgg  c.2884-3361

.         .         .         .         .         .           g.83015
agaaagatgttagaacaatcatatatattgatctttctcttaaaaagtcttcactgatat  c.2884-3301

.         .         .         .         .         .           g.83075
ttaacatgcagattgacaccggtacctatgtggtaggtacgtatgtgtgtctgaaagcga  c.2884-3241

.         .         .         .         .         .           g.83135
gtcatgtgctgggagtacactgtgtaggttatcccaggggaagcgtgagagtgggtttcc  c.2884-3181

.         .         .         .         .         .           g.83195
accactgggagcatctgatagtcctttcatccttgctgcctggttcatttactttctgcc  c.2884-3121

.         .         .         .         .         .           g.83255
aatggtggtgaggccttatgggtttccccgtgcccagataaggagatttagtatgatctg  c.2884-3061

.         .         .         .         .         .           g.83315
attttaactaaactaacaaccctggtccccagaagggcttaaaaggattctgcaaaggag  c.2884-3001

.         .         .         .         .         .           g.83375
tgcaggttgaaatcacataggcatagatgaacaatgggaaaaaggccatcttgtctcttt  c.2884-2941

.         .         .         .         .         .           g.83435
tcccattcctagtattggttttcaacagccacatcatggtacatgggctggagttgacca  c.2884-2881

.         .         .         .         .         .           g.83495
aaaatattagatatcatcaaattggcagctttaaatagggctataaatcaacttccttta  c.2884-2821

.         .         .         .         .         .           g.83555
acattgacctgtgccctgaaagtaactcatatcttgagacattaatattagtgcatgcat  c.2884-2761

.         .         .         .         .         .           g.83615
atagtaattcataaataaatatgtagatatatgttgggaaaatgagcttcagcatgtctt  c.2884-2701

.         .         .         .         .         .           g.83675
cttgtttttcttctccattatcaaaaaagcttactgacaaacttctttgagagaaatgaa  c.2884-2641

.         .         .         .         .         .           g.83735
agggaaattggctttggctgatagtgtgattgggaaagatcttaaaaagggccctcaagg  c.2884-2581

.         .         .         .         .         .           g.83795
tagagtagagttagaaaggagccttaagactaagtaaggatatcccaggcctggagacaa  c.2884-2521

.         .         .         .         .         .           g.83855
gtacaaaaacaaaccaagtggcctggagttgtttgagaaggctctgggagcaaacataaa  c.2884-2461

.         .         .         .         .         .           g.83915
atatagttgtgaagcttatgtgatttttgatcctgtgtattaaatgccctaattgtgtga  c.2884-2401

.         .         .         .         .         .           g.83975
ggaaagagactctgccttctaagagcagccatcaggtccttgagagctgcttgcctctct  c.2884-2341

.         .         .         .         .         .           g.84035
gctgacttgacctcgttgagaatgcttggcatccctgtctccatggtatcaccatgcatg  c.2884-2281

.         .         .         .         .         .           g.84095
cctcctgctttccaaactccttcacctccagcccttagcagtggctgactcataggaagg  c.2884-2221

.         .         .         .         .         .           g.84155
tgcttgagtgttctttcctgaattctggatctgccttccccaaatgcacaagcatcagcc  c.2884-2161

.         .         .         .         .         .           g.84215
atgccttccacattcaggaaggtttgatcaagccagcagggaggtgcaggtgaaggtgaa  c.2884-2101

.         .         .         .         .         .           g.84275
cctcaggcagagctaggaagcctgaaaatctcctcagtcgtcctaacgtggagcttaaaa  c.2884-2041

.         .         .         .         .         .           g.84335
gagtggattctatttcaaatcctaactgtgccattcaatagctatatctttgggtctgta  c.2884-1981

.         .         .         .         .         .           g.84395
gctaaacctctgtggtgctcagattcctaatctataaaatgagaaggctaaatgtggcta  c.2884-1921

.         .         .         .         .         .           g.84455
tcccagtacagctcttttgtgtgttaaatgagagaaggctcagaaagcactttgcacagg  c.2884-1861

.         .         .         .         .         .           g.84515
gctttttctgtggaaagagcccagtaatattagtccttgatgtcattttaccattatact  c.2884-1801

.         .         .         .         .         .           g.84575
tgttaaagtctaaagttgttcagcgtttttctttacccttatcaaatgtcactgtgagtt  c.2884-1741

.         .         .         .         .         .           g.84635
aacagctcttgaaaaagtagaagcctggggtaatcatttcacaatgtttatgtatatcaa  c.2884-1681

.         .         .         .         .         .           g.84695
aatctcacagacgtaccttaaatatacacaatatgtatttgtatatattatacctttcta  c.2884-1621

.         .         .         .         .         .           g.84755
aaatattataccttgatacaattatacctcaatacagctgaaaaaattagaatttttttt  c.2884-1561

.         .         .         .         .         .           g.84815
tttttttgagacagagtcttgctccgtcacccaggctggagtgcagtggcgtgatctcag  c.2884-1501

.         .         .         .         .         .           g.84875
ctcactgcaacctccgcctcccgggttccagcgattctcctgcctcagcttcctgagtag  c.2884-1441

.         .         .         .         .         .           g.84935
ctgggactacaggcacacaccaccatgcctggctaatttttgtatttttagtagagctgg  c.2884-1381

.         .         .         .         .         .           g.84995
ggtttcattatgttggtcaggctggtctggaactcctgacctcgtgattcgcccgcctcg  c.2884-1321

.         .         .         .         .         .           g.85055
gcctcccaaagtgctgggactgcaggcgtgagccaccgcaccgggccaaattatagaaaa  c.2884-1261

.         .         .         .         .         .           g.85115
ttttcataaaaaaaaaaggagaagtactttaaacatataacatgatcagttatctaaaac  c.2884-1201

.         .         .         .         .         .           g.85175
acaaagcctgtattaaatgcatacttattgattaatcttggagatttttctttcacctgg  c.2884-1141

.         .         .         .         .         .           g.85235
ccaagaaggtcattaaagactaaagcatgtttttggagggttacttacacttctcacctt  c.2884-1081

.         .         .         .         .         .           g.85295
ttctgtaaaagagcgggcttttctctaatctcatttgatgcatgaaaatgtgtggccaga  c.2884-1021

.         .         .         .         .         .           g.85355
aactattaattgtgcttccatgtggcctgacagattccttcgaaagcaacaattgaagga  c.2884-961

.         .         .         .         .         .           g.85415
atattcaagttctctgtgacctcttctccctggccctcagagctgcaaataatgtgatca  c.2884-901

.         .         .         .         .         .           g.85475
ttttacatcagtttattaaacattagtcagcttgctgatttatttttaatcacattctgc  c.2884-841

.         .         .         .         .         .           g.85535
atatttctaggcattaatctgatgtttattatgagaattgcacatttgtattattgggat  c.2884-781

.         .         .         .         .         .           g.85595
tctttattaaataaagaaaaacaatggtaggaaataaggcagattttatgtattaggagt  c.2884-721

.         .         .         .         .         .           g.85655
atgataaagtacgcaggtgtgtgataaaccatgagcatgtgaattccccttaacttttta  c.2884-661

.         .         .         .         .         .           g.85715
aaattggattttgatggtatttcaactggaagcacaggaggccttgtcctcctttagatg  c.2884-601

.         .         .         .         .         .           g.85775
accataaagtagtgtccaattgtggattaatttctcttccacctgttctcactatgttgt  c.2884-541

.         .         .         .         .         .           g.85835
atcctgccatttctcaagagtagaagttaatggtagtcaccctagggatgttataaatct  c.2884-481

.         .         .         .         .         .           g.85895
cactttaagactagtattagagataccacatgtgaccatttaaaaatgtttcacaaagaa  c.2884-421

.         .         .         .         .         .           g.85955
aatcacaggatatttgccagtcactgcttttcctaaaaccgttctgttcataggaaagga  c.2884-361

.         .         .         .         .         .           g.86015
agtataattgggaagtgaaggaaatgctaaaaatatcccatattgaacatttttgaattt  c.2884-301

.         .         .         .         .         .           g.86075
aaacagtttgtaagccattctctctctcaaatttggaaccaagtcaagaaatttcagaaa  c.2884-241

.         .         .         .         .         .           g.86135
acatgaccctagcatcaattacatataaccttcagaaggcccccccatcataatggtacc  c.2884-181

.         .         .         .         .         .           g.86195
ttgaacaatgatgactctggtctcttctaacacccccatctcaccccgcactccgtgaat  c.2884-121

.         .         .         .         .         .           g.86255
ccaagaaagagaaagagagacacctttgtgcttccaggagtgacactgactcagcagtct  c.2884-61

.         .         .         .         .         .           g.86315
tcttagaacaggcgccttctccttcctgctcttgcctacttactgttctcttttctgcag  c.2884-1


Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center