SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2) - 6084 nt intron 23 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.93888
gtaagtgcataaggcattaggctcggaagccatactactgaaaatgaagggataatgggc  c.3292+60

         .         .         .         .         .         .  g.93948
acttaggtccaatctcagccaaaaagaaggggtaaaattgaagaattgactagaagcatt  c.3292+120

         .         .         .         .         .         .  g.94008
gggagcagtttttctagatagcaattttttgcatccttaagctttaaataagctgacctc  c.3292+180

         .         .         .         .         .         .  g.94068
atttgtgcagctgcatagcccacaaataaaccaacacaaatgagtttagagtcacttttg  c.3292+240

         .         .         .         .         .         .  g.94128
agtacctaaataaaataaaattaaactaaattaaaattttaaaatcttccttgctcttaa  c.3292+300

         .         .         .         .         .         .  g.94188
aattgttacctatgtgccaaagatatagaatacattgacacacctttaactttttcagtt  c.3292+360

         .         .         .         .         .         .  g.94248
aaggcatattttaaggggataaaggctatgtcacttttctttgtaacaatacaatcattc  c.3292+420

         .         .         .         .         .         .  g.94308
atttaagattatatttatcattaaagcccctctcttcctaaataagacgtatccacatgt  c.3292+480

         .         .         .         .         .         .  g.94368
tacattgttaagagacatgacttcattgtttcctggattttgcaagctatgtaaaatatt  c.3292+540

         .         .         .         .         .         .  g.94428
tgcctggttttaagagtgaaatttaaataccgtgtcctaaaaattagtaagaaaaaatat  c.3292+600

         .         .         .         .         .         .  g.94488
taatggaagcaaatatgattttagggataatccctaaattattttacgatttggatatca  c.3292+660

         .         .         .         .         .         .  g.94548
gccataatatattagaggttgaaagtatcagcatttatacacaatggaagggcataaata  c.3292+720

         .         .         .         .         .         .  g.94608
tggcattcaaagagtggtaagtaggaatagaagttaatttacagtcaggatgctatttaa  c.3292+780

         .         .         .         .         .         .  g.94668
tccctgggtagaaaagaggatactgctaataccagtatttatctaatgcagtattactat  c.3292+840

         .         .         .         .         .         .  g.94728
tgttaaatgggaaacttaaggtttatgtttcattaaaagactttattttcaatccaacat  c.3292+900

         .         .         .         .         .         .  g.94788
tttgttttcctttttgccttaattgaacgtaattggatagataccaaactcagacttgcc  c.3292+960

         .         .         .         .         .         .  g.94848
gtatgttctctgacttaaggttttaggtgaattctctttatggtctgcctcttagggtat  c.3292+1020

         .         .         .         .         .         .  g.94908
tgttaattaattttcaaattaattataccatttgacaaacttgatttttttttttatttt  c.3292+1080

         .         .         .         .         .         .  g.94968
attttgtttttattgagacagagtctcactctgtcacccaggctggaatgcagtggcatg  c.3292+1140

         .         .         .         .         .         .  g.95028
atctcagcttactgcaacttctgccacccgggttcaggtgattctcctgcctcagcctcc  c.3292+1200

         .         .         .         .         .         .  g.95088
cgagtagctgggattacaggcatgtgccaccacgcccggctaattttttttttttgtatt  c.3292+1260

         .         .         .         .         .         .  g.95148
ttttagtaaagatggggtttcaccatgttgcccaggctggtcttgaactcctgacctcaa  c.3292+1320

         .         .         .         .         .         .  g.95208
gtgatccacctgcctcggcctcccacagtgttgggattacaggcatgaaacttgattatt  c.3292+1380

         .         .         .         .         .         .  g.95268
taaacccctttacctctcccctccaaattacgtaatgaatgaatggttacgtaaatgtca  c.3292+1440

         .         .         .         .         .         .  g.95328
atttttagttcacaaatacagtcctattaggcacagtttttctctgttggcaaatttcct  c.3292+1500

         .         .         .         .         .         .  g.95388
ttattgtctcttctcctttgactggatccctgcctccggaaagtggaaaattcggcactc  c.3292+1560

         .         .         .         .         .         .  g.95448
ttctttcaaaagacaaactgtcctttacctgctgctcaagtgaggggctgtggggttgtg  c.3292+1620

         .         .         .         .         .         .  g.95508
gggctgtattttcccctgaactgacagccccacacaggcgtcctgcgtaactatcacttg  c.3292+1680

         .         .         .         .         .         .  g.95568
ctactttgtggcatttcatttccaatctcaggtctctgacgactgcttctttggaatatt  c.3292+1740

         .         .         .         .         .         .  g.95628
tgcatctctcaaactggtaagaagtgacttcctggaaacaaattgctttcatgttttctt  c.3292+1800

         .         .         .         .         .         .  g.95688
gtcagcctgagaggttctctttaatagtttattggctgctgtccttttgttagtaatagt  c.3292+1860

         .         .         .         .         .         .  g.95748
cacaacagctaacatgtatggaacaccgctctgtgggactctgggccaagcatttcatgt  c.3292+1920

         .         .         .         .         .         .  g.95808
gcattattaatttgattttctcaataaataagctactgttatccctgtcaaccagtgtgc  c.3292+1980

         .         .         .         .         .         .  g.95868
cattatgatgcccatttaaggatgagaaaacaaaggcatatggtgaaaccaggttctaac  c.3292+2040

         .         .         .         .         .         .  g.95928
ttggatctgtttgattccaaattagctgagttttagcagatccagagaggtataccccat  c.3292+2100

         .         .         .         .         .         .  g.95988
ctctgaaaatacaggcttcttctctagctacaacattttaagaatgattttgaacttatt  c.3292+2160

         .         .         .         .         .         .  g.96048
taaaattttcaattgactaattgcaaaccaccatgcactagagatacaggatggatgaac  c.3292+2220

         .         .         .         .         .         .  g.96108
tattcactgttgctgctctcagagtccttaccattaggtggaaggagacagacaagcaaa  c.3292+2280

         .         .         .         .         .         .  g.96168
ttgcctaacatgttacagatggaattgaaaaggcatctttccgtaagaaacagcagccgt  c.3292+2340

         .         .         .         .         .         .  g.96228
tccttttaagggtggacagaactaatggacaaacaatcaatatacacacagataagttag  c.3292+2400

         .         .         .         .         .         .  g.96288
tacacacacttccagctgaacccccttctgtcccccatcccaccacccaattattaaaat  c.3292+2460

         .         .         .         .         .         .  g.96348
gacttcagattttcattgctgaatttgatgtctcagattttgactttaggggaaaaaaaa  c.3292+2520

         .         .         .         .         .         .  g.96408
tcacttgatgagagctaagcagaaattttctgcaaagattatggttgcatgaatagattt  c.3292+2580

         .         .         .         .         .         .  g.96468
agctaatactccatatagtttttgtttttactggaaatgatttttgagtgagagcaagtg  c.3292+2640

         .         .         .         .         .         .  g.96528
gtgaggttttatcccagaagacaacactttctaaaagcaggtgaaactaagttaaaatta  c.3292+2700

         .         .         .         .         .         .  g.96588
gtcatcatgaaagtctgacagtgtgttccttctggtaaattctgtaattttcaacacagt  c.3292+2760

         .         .         .         .         .         .  g.96648
tgccctattaattgtatgcttataattggttatgtatcaaagtctgaaagaccatgaaac  c.3292+2820

         .         .         .         .         .         .  g.96708
tgatgttagtattgagcacgttaaatcttgagccacttgcaaggagtgtctgcctttgga  c.3292+2880

         .         .         .         .         .         .  g.96768
tagactgttacatggtagtttgaatctccctgaacaatattaaaaattttgttaaattta  c.3292+2940

         .         .         .         .         .         .  g.96828
acaaaaaaaatttgttaaattaaaaaaatatttgttaaaaagattgctgatgatcagcaa  c.3292+3000

         .         .         .         .    g.96870
agatcttgacttggaaatctttgacagaaagggttttctagc  c.3292+3042

--------------------- middle of intron ---------------------
     g.96871        .         .         .         .           g.96912
     c.3293-3042  aaattgcaaaccttatgataagaaatgccatagctttgtatg  c.3293-3001

.         .         .         .         .         .           g.96972
aaaaatgacttaatcttttttgttttttataatttgtcaagttcccagctatttatacag  c.3293-2941

.         .         .         .         .         .           g.97032
tttatttaatttaattttattttattttattgagacggagtctcgctctgtcccccaggc  c.3293-2881

.         .         .         .         .         .           g.97092
tggagtgcatctcggctccctgcaacctccgcctcctgggttcaagcaattcttgtgccc  c.3293-2821

.         .         .         .         .         .           g.97152
caccctcccaagtagctgggattacagatgtgtgccaccatgcccagctaacttttatat  c.3293-2761

.         .         .         .         .         .           g.97212
ttttagtagagatggggttttaccatgttggccagggtgatctcgaacccctgacctcag  c.3293-2701

.         .         .         .         .         .           g.97272
gtgatccgcccaccttggcctcccaaagtgctgggattacaggtgtgagccaccatgcct  c.3293-2641

.         .         .         .         .         .           g.97332
ggcctatacagtttaaatacacaccagatatatggttggcctgtttgcttgaggtatctg  c.3293-2581

.         .         .         .         .         .           g.97392
ttatagggtctgaaaactcctttgaccaaataattttatttggatattccttttgttttt  c.3293-2521

.         .         .         .         .         .           g.97452
cagtgctttattttgcatgtaaggttatttcatctcagtaggcattggttgtatttatat  c.3293-2461

.         .         .         .         .         .           g.97512
cttatgttactggccagatccacgtctgttctgcccacgtgcagtaaatcaatcactgtg  c.3293-2401

.         .         .         .         .         .           g.97572
acacaggttttgcaaaagagaaaagatttattcacaagggcaccaagcataaagatggaa  c.3293-2341

.         .         .         .         .         .           g.97632
gaacagccctcaactctacctccctgaagataaggtttagggatatttatggggtaagga  c.3293-2281

.         .         .         .         .         .           g.97692
agtggggtggtgtaaggcacagggaaaggtgattggcagtggggaaaaatgaaatcacag  c.3293-2221

.         .         .         .         .         .           g.97752
gttcgttctacacaggcatagccagggttcatggcatttcctaggacatacatacaaaaa  c.3293-2161

.         .         .         .         .         .           g.97812
atggcagagtcagcatgatctgatggtggagtttttggctctccaacatcaaaaggccat  c.3293-2101

.         .         .         .         .         .           g.97872
ctcttgggcacttgcgctcaggcccagtttaagggccagtggtgtcaacgggtttgaact  c.3293-2041

.         .         .         .         .         .           g.97932
ggacagagctggccaaagttcctgaaaaacaactgaagtaaccattaccatggtgacgta  c.3293-1981

.         .         .         .         .         .           g.97992
tgcatgttatctgtaaagtagccagtgaaggtcaagtttgagcattcagcagcaagacct  c.3293-1921

.         .         .         .         .         .           g.98052
tcagctactgcagccttcagcttcatggaaaaagagaaaacaaaaataacaaaaagcaag  c.3293-1861

.         .         .         .         .         .           g.98112
aaaccagaagcatgcagggcaggcagacctgatgagattaactgttcggtttcattaatc  c.3293-1801

.         .         .         .         .         .           g.98172
cgtgtgattatcagctggttcattttcagttaatcaaaactgttgaacttctatcctgag  c.3293-1741

.         .         .         .         .         .           g.98232
agtatagatgtatagttttgtacccagttttcagaaacacagatgccatgatctcttctt  c.3293-1681

.         .         .         .         .         .           g.98292
tccccattttagaagaaatttttggtttctgtggcttttcattcagtttaaggcagagga  c.3293-1621

.         .         .         .         .         .           g.98352
gaaatatgtgaaccattaatacatgtaatttttaaaaaaattcttgtagctggaaagatg  c.3293-1561

.         .         .         .         .         .           g.98412
atagagaaggtttcacagcagaaatatcttccattagcgtcgtgaacagatagttcacca  c.3293-1501

.         .         .         .         .         .           g.98472
tgatctcagaaagccaattctgaaaataaaagaaaaaagagccccacatttgaaagctca  c.3293-1441

.         .         .         .         .         .           g.98532
ctcatcaaagcatgtttagtgctcctcctccaaaatctaaactcggacagttgattgtgt  c.3293-1381

.         .         .         .         .         .           g.98592
cggacctcaccagttcactaaactcgaaacctaatgtagaaagtaaattgggtctaaaga  c.3293-1321

.         .         .         .         .         .           g.98652
atgtgactccatgtgactcaatgagagcccccagacccctcatttctaatccctgtttgc  c.3293-1261

.         .         .         .         .         .           g.98712
tgtatgcagggaagtgatttgttttctccctcttcaggagggcatttgttatttttatta  c.3293-1201

.         .         .         .         .         .           g.98772
aatgtgaaaaacagatcgtccccatgtttgagaacttggccctcatagtaacttgatttc  c.3293-1141

.         .         .         .         .         .           g.98832
attagctatagtcacttaaatgttttaatcctctgaaataaattgctggtatgttttcat  c.3293-1081

.         .         .         .         .         .           g.98892
ccttaaaaaatgaacagcatgtaggaataatatttgaagagcagctggtcagagactgtc  c.3293-1021

.         .         .         .         .         .           g.98952
atgtaacatgcatacatatttcccaacagcctaaagccttctttcaaaattcagcatcta  c.3293-961

.         .         .         .         .         .           g.99012
agcttttctggtgaaatatgttcagatggaatactggtgttttttttttctccccttcca  c.3293-901

.         .         .         .         .         .           g.99072
caatgcatttcatgaaatggctgggtaaatacattacacatacataatatgtgattgagt  c.3293-841

.         .         .         .         .         .           g.99132
ggctcatctggaatgcaagaatgccccaaaagtgagcaccagactctgaggtttggtact  c.3293-781

.         .         .         .         .         .           g.99192
gtctgcttattcactattttggagcctcttcagaccccatggggcaaaccacccccaagt  c.3293-721

.         .         .         .         .         .           g.99252
atttaacatgctgctctgtttagttggttttgatttagcatgctttgaactcaacagagc  c.3293-661

.         .         .         .         .         .           g.99312
aggatgataacgtgagaaacagactaagagatttcttgtggggggggtggggattattgt  c.3293-601

.         .         .         .         .         .           g.99372
ggctttaagtcttgctaacaaggataaaattattccatttgcaaaaaaaaaattacattc  c.3293-541

.         .         .         .         .         .           g.99432
ataatttatgtttttaccaaccagaccatacttagtagtaatccaaatggtaaagtagta  c.3293-481

.         .         .         .         .         .           g.99492
gaaaagaactttccttttttttctattttcttggcataaaaaaagtccttgctttaatgc  c.3293-421

.         .         .         .         .         .           g.99552
ctattggcaaagtttatttaagccattattacagttttaagtgcacgtgtgtgtgtgtga  c.3293-361

.         .         .         .         .         .           g.99612
gagtgaaagagacagggcgagagaggaagtgtgtgtgttcttaaaattatttgttgttat  c.3293-301

.         .         .         .         .         .           g.99672
aaatcacagaaataaatccaaaaaatgttttcattgttttaggtgagagtaaggattttg  c.3293-241

.         .         .         .         .         .           g.99732
taaaatttgtgaagttgcgaagatgcctcattagaaatgtttaagctgtttctttctttt  c.3293-181

.         .         .         .         .         .           g.99792
tttttgtaattgcaaaatgttcaaagttttttatccagaagtacaaagccctggaaatta  c.3293-121

.         .         .         .         .         .           g.99852
cctcaccagtgttaggaggagtctgggtatatttcttgaaggaagcaagcctttttgtct  c.3293-61

.         .         .         .         .         .           g.99912
cattctgtgccattttcagacaagagttaattggcaaattaatttttctgatcccctcag  c.3293-1


Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center