SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2) - 5404 nt intron 24 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.100136
gtctgcatgtcccactcaggtgcccaggcctccctctggagagcaactaaaagatgatca  c.3456+60

         .         .         .         .         .         .  g.100196
gtttcattattcacatttacaggacagagcaaatatctaaacgagtgggctgttgctttc  c.3456+120

         .         .         .         .         .         .  g.100256
ttggagccaattcttctggctgttttcttatctcccttagagcatagatacgaggtccca  c.3456+180

         .         .         .         .         .         .  g.100316
catatgcctttgaagagctgaagtttgaggtagaaaaacttagtttctccttagttttaa  c.3456+240

         .         .         .         .         .         .  g.100376
tcccatctcttgggattgccattgaacaaagtatatttaatgagggataagtcaaaaatg  c.3456+300

         .         .         .         .         .         .  g.100436
ttgcaaaatcatagcagtaagaacaatagcaaccatcattcatgggacccttaatctgtg  c.3456+360

         .         .         .         .         .         .  g.100496
tcagcctcttgggcattttttcattcagttttacgacaaccctgtcagacggttaatatg  c.3456+420

         .         .         .         .         .         .  g.100556
atttgaatctttgcagtcaaggaaactgaatcctaggcagggtaagtaacttccccaagg  c.3456+480

         .         .         .         .         .         .  g.100616
ccaaatagtattacagtagttaaccttttattttgtgttttatttaaagtcatcatcaaa  c.3456+540

         .         .         .         .         .         .  g.100676
acatattctaatgagcatttattgttgtaaagctcttttagccaggtaagttcagggcta  c.3456+600

         .         .         .         .         .         .  g.100736
tccttttaaagcagtactttgatgttttgtttttttttttttaaattgagcgggtctctc  c.3456+660

         .         .         .         .         .         .  g.100796
atggcactggttttctaagttactctgggaggtgaggcatctgcctgtaggatattgggt  c.3456+720

         .         .         .         .         .         .  g.100856
agggtgatattggtcaagatttgattcatactggagcaaatgttgaattcaaaacagtaa  c.3456+780

         .         .         .         .         .         .  g.100916
aaatgaagagcaggtgtggtggctcatgcctgtaatcccaggactttgggaggttgaggc  c.3456+840

         .         .         .         .         .         .  g.100976
aggaggattgctttgagcccaggaatttgagaccagcctgggcaacatggtgaaaccctg  c.3456+900

         .         .         .         .         .         .  g.101036
tctctacaaaaaaatacaaaaattagctgggcacagtggcacttatacctgtagtcccaa  c.3456+960

         .         .         .         .         .         .  g.101096
gttcctcagcaggctgaggtgggaggattgtttgagtctgggaggcagaggctatagtga  c.3456+1020

         .         .         .         .         .         .  g.101156
gccatgatcgtaccaccgctctccagcccgggcgacaaagcaagaccgtgtctcaaaaaa  c.3456+1080

         .         .         .         .         .         .  g.101216
aaaaaaaaaaaaagaaaagcaaaaagaaaatggcaactctcacgtaggagtatgaattct  c.3456+1140

         .         .         .         .         .         .  g.101276
acatcagcttttcctaggctcctcgttgagccctggttttctcaacagtaacactatctc  c.3456+1200

         .         .         .         .         .         .  g.101336
actgggttgcgaagactgagtggcagtgccatatagcgtcacttttggcaggaaatcaca  c.3456+1260

         .         .         .         .         .         .  g.101396
ttcaggggtacattaaaattctaagggagcttttaaaaaatatgcatgcctgctttctgt  c.3456+1320

         .         .         .         .         .         .  g.101456
tccctgccaccgcaccccagttttcttattcggtggagctaggtgcttcctttgagcgct  c.3456+1380

         .         .         .         .         .         .  g.101516
cccaggagattctgaaatagattctcatacagatgaggagcactgatttaaagactcaac  c.3456+1440

         .         .         .         .         .         .  g.101576
tgtgggcccaaaccaccaacactgggccactgcgtgtacttaccattctctgtaggtgaa  c.3456+1500

         .         .         .         .         .         .  g.101636
taaattaaagcgactattaaaattttctgatcttgaaaaggattgggagccaccagcaca  c.3456+1560

         .         .         .         .         .         .  g.101696
gaatatattagttctaagtcttcaggaaatatggttacgtatttttataaatacataaaa  c.3456+1620

         .         .         .         .         .         .  g.101756
gtgtttcattccaaggctcaggtagaattcatattgatgtgagagatctgcagtttttct  c.3456+1680

         .         .         .         .         .         .  g.101816
ttttagcattatggattcagtatttgttccacaaacatttattgagtgtctgttatgcag  c.3456+1740

         .         .         .         .         .         .  g.101876
caggcagtgagctaggctgggtatctaagggggaggaaggaagacgtgatgtgactcctc  c.3456+1800

         .         .         .         .         .         .  g.101936
tcctcctggtgtgctcaatgtgattggatgtttagattatccttgctggtacctaagttt  c.3456+1860

         .         .         .         .         .         .  g.101996
tgaggacgatctataggtgaatggagagtttgcttgtattctgtcttcggaggtaagcat  c.3456+1920

         .         .         .         .         .         .  g.102056
ttccactgactcttagatgtttaccttcactggcacagtatacagtataaatcctaaaag  c.3456+1980

         .         .         .         .         .         .  g.102116
ccactgttccaggaaatgctaatttaacatggaaaataactctgggacatctgtatgatg  c.3456+2040

         .         .         .         .         .         .  g.102176
ttccaccccaccccgcctctcatttttttttttcgtactttctctctagctctgttaaaa  c.3456+2100

         .         .         .         .         .         .  g.102236
actttgaactctagaatcaaagtaaattgcagtaacatgaaatagtcccctcttaactac  c.3456+2160

         .         .         .         .         .         .  g.102296
atgggaactaaagctttggcagcaaaacacaggatcccagattttctctggtggaattta  c.3456+2220

         .         .         .         .         .         .  g.102356
caacaggttcctcacactgggcctctgcaagtatttctagctgccataggtagattcact  c.3456+2280

         .         .         .         .         .         .  g.102416
tccacctgattgaataaactgagctgaccagatttttcatctgtcactgaacaggaccat  c.3456+2340

         .         .         .         .         .         .  g.102476
tagtttggtcaaatttttctttttcaggaatcagtgattttatagtgataaagatccatc  c.3456+2400

         .         .         .         .         .         .  g.102536
tgagttttcatttaaaaggtacagaactctactaaatattgttaggcactttgcatacct  c.3456+2460

         .         .         .         .         .         .  g.102596
cacctcaagtaatcgtcaaaatatcttctacataaggaaaccagtcaatgttagcttgct  c.3456+2520

         .         .         .         .         .         .  g.102656
catgaacaccccaccaggatcattcacacccatgtctgtttaggtttcagtttgaatact  c.3456+2580

         .         .         .         .         .         .  g.102716
gggtttgagctctttctaccttgcacccttgcatatagattgtatagcccccaaaatgaa  c.3456+2640

         .         .         .         .         .         .  g.102776
aattgtgaaggtctttgtatcaggttaattttagcatgcattgaagaaaaatttctataa  c.3456+2700

    g.102778
gt  c.3456+2702

--------------------- middle of intron ---------------------
                                             g.102779         g.102780
                                             c.3457-2702  at  c.3457-2701

.         .         .         .         .         .           g.102840
gcattatcatgttgaatcaaaattaaggcacattggtgaaaataggggatttgacatagg  c.3457-2641

.         .         .         .         .         .           g.102900
ttgacagatagaggccttaatgttgctgattgaggaccctacctagaagcaaagatagaa  c.3457-2581

.         .         .         .         .         .           g.102960
ctcgtgattgtggaattaacaaaaaaaaatcccaccaggttgccaagactctcatttcca  c.3457-2521

.         .         .         .         .         .           g.103020
aactgttggttagaaacatgggttggtactcgtgttttttacccacggagctgcagctgt  c.3457-2461

.         .         .         .         .         .           g.103080
gttgctattacggaatggtcgaccacatttagcttgcagaccctcttctcagaccaggct  c.3457-2401

.         .         .         .         .         .           g.103140
cttagcttcaagtattatcagacctaagtcagtgtgatgaagtttcagaccaccgaagtg  c.3457-2341

.         .         .         .         .         .           g.103200
agacttcagaaacatggagtaatccatccaataattacagcacttctttgtcacaatatt  c.3457-2281

.         .         .         .         .         .           g.103260
ccccccacattttggcttagggactcaagctcacatttcgttaaacttctccagtctaga  c.3457-2221

.         .         .         .         .         .           g.103320
aatattagcttttgtgaccttccaattagatgggtgatctgaaacacacaaacacacatc  c.3457-2161

.         .         .         .         .         .           g.103380
actgctaccaccaccaaacgaaacttaactgcagcaaattcccaaggattctgtaatgtc  c.3457-2101

.         .         .         .         .         .           g.103440
tgaccgtgttcctatgttgtccatgtgccctgcttcctcacctgttctattcatattctg  c.3457-2041

.         .         .         .         .         .           g.103500
ctgccccctgcaattagtatttttgtggttttgtcagcatcttcttggacaagggtcagc  c.3457-1981

.         .         .         .         .         .           g.103560
aatctactactcgcgggctcggtctgacctgccccttgtttttgcacccccacaggtgaa  c.3457-1921

.         .         .         .         .         .           g.103620
gaatggttttcactttttaaagtataaattagaaaatggtggggaaaaagagtatcagcc  c.3457-1861

.         .         .         .         .         .           g.103680
ttctggtgagaacagttgttcaatttttgcttctgggccagacagcatagaacgtttact  c.3457-1801

.         .         .         .         .         .           g.103740
attgcgcccattttagagactgttggcctctgttccaggagatagtgaaaagcctcatga  c.3457-1741

.         .         .         .         .         .           g.103800
cacagaccttgtcatcttgactgctgttagcaggtctggtgaagatatgtggagagggac  c.3457-1681

.         .         .         .         .         .           g.103860
ggttgaactaaaagcttaaaaaggaactttagggtgttttaaagttctttgtcccctttg  c.3457-1621

.         .         .         .         .         .           g.103920
gatttgaatgatccaccttacattctcctctttagaaaataatctaatatagatgggtcc  c.3457-1561

.         .         .         .         .         .           g.103980
cagctgttttcatggcttagcactatgatatttatattaacttattcaaatatctgctga  c.3457-1501

.         .         .         .         .         .           g.104040
ggaagaagttttgcctaattggctacttaattttaaaggtccctgcagcaaaaacaaatc  c.3457-1441

.         .         .         .         .         .           g.104100
tccagggcagccttttgtctgctgccttcttgtgctacaacaggtgaccaggagacttgt  c.3457-1381

.         .         .         .         .         .           g.104160
ctggtcaagaagacgggtttacagctgttgagcatcagctctctgcaaattatggtgcca  c.3457-1321

.         .         .         .         .         .           g.104220
gggatgtgggatacagaaaacagacttttgccctaaaaatctatacagtctaatgggaga  c.3457-1261

.         .         .         .         .         .           g.104280
catgtgtaaacaactaattagcatcagctcagataacatcacctggaccacaatgaataa  c.3457-1201

.         .         .         .         .         .           g.104340
aagccacatgccaagaagtttttattacgtagctataaaattaggtaattctgtttcatg  c.3457-1141

.         .         .         .         .         .           g.104400
ggctcatgaaggtttttatttaaaaatttcatgaaagcttttttcttattattaatatat  c.3457-1081

.         .         .         .         .         .           g.104460
gagtaacatttaaagcagaaaaaaagcaaaatgtaagcaaagtgaagaaagtgaaataac  c.3457-1021

.         .         .         .         .         .           g.104520
acctataatcttatcacctggagatttacgttgttggcatgttggtgtttgtcctcctac  c.3457-961

.         .         .         .         .         .           g.104580
ctttttctttatatagataaatttgcacatgtaagatcagaatgcacatggttcttttta  c.3457-901

.         .         .         .         .         .           g.104640
acttgttttcacttatgtcattaaatctcctacaatataatttttatgatactttgttga  c.3457-841

.         .         .         .         .         .           g.104700
tacatacatatagtaggatactataattcatttaactaattcagtattgttgaatgtttc  c.3457-781

.         .         .         .         .         .           g.104760
tttttttaaaaaaaaagccattagagagagtaaattattctgagaaggtacatccttatt  c.3457-721

.         .         .         .         .         .           g.104820
tctaaatctttgtgcatatctatgattatttgtttaggatacatttccgaagtaatattt  c.3457-661

.         .         .         .         .         .           g.104880
ctaagtcggagacatagacagttttaacacttctaataggtagtgacaaatttctgtccc  c.3457-601

.         .         .         .         .         .           g.104940
caaaagtttaccagttgactacccaactagcaatccttttgatttcccagattgaagacc  c.3457-541

.         .         .         .         .         .           g.105000
gagtctttgataaggttaggttcgaggaaattgactacctgagcagtcagtgtgtgtgta  c.3457-481

.         .         .         .         .         .           g.105060
tgtgtgtgtgtggtaagatgtatgtatgtataatacctgaatgtacaactcagtgatatt  c.3457-421

.         .         .         .         .         .           g.105120
tttaaaataatcttcaacacatcacgccaaagaaaaggcgtttcttgcaacttaaggtta  c.3457-361

.         .         .         .         .         .           g.105180
gttgtaggtgttatgtaagtcataattctgacattggacattggtgtcttgtttaatgtt  c.3457-301

.         .         .         .         .         .           g.105240
ttagatatggactaaatctgatggggaacctagagacagataaaaacaatatgatacctg  c.3457-241

.         .         .         .         .         .           g.105300
gatttcaaaacctgagatgtatttcagttggcttggttaatttcaacccaggtttcttca  c.3457-181

.         .         .         .         .         .           g.105360
actaggaatgacactgaatttttccaaacgtagcttgtgtgtttttaaaatgtaggcaaa  c.3457-121

.         .         .         .         .         .           g.105420
atcttaccttagtgaaggtgaaatacagaacccttccatatttccctctggggtggggtc  c.3457-61

.         .         .         .         .         .           g.105480
cggttttggatgcctatgccaggcatctcagtcctcatagcatattgaccccccaaacag  c.3457-1


Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center