SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2) - 3408 nt intron 25 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.105768
gtattagagaaaaccccaagtttatgaaatcaaacagtggccttttgtctctgaaggact  c.3684+60

         .         .         .         .         .         .  g.105828
cagaataatccctttgtttaaaaaacttcctgggctggcgttaatgaaaatgaagaaata  c.3684+120

         .         .         .         .         .         .  g.105888
aactgctgttttagatcccaaccacagaaagcctgtgaaagttatccaaaatgagtgtct  c.3684+180

         .         .         .         .         .         .  g.105948
taagagctatggctggaggaacctcaaggcttggcctgtgggtgctccctcctttttccc  c.3684+240

         .         .         .         .         .         .  g.106008
agggtggtaaaaccagctgctttattgaaccatcagtgctgccttctgtagggcagatgc  c.3684+300

         .         .         .         .         .         .  g.106068
agaactgcagaggatactttagggacaaaatcagccggacgagacaagacataaatggaa  c.3684+360

         .         .         .         .         .         .  g.106128
ggggtcctctttctctcatcctccagagccctctctctcttttgccttttgatcagggat  c.3684+420

         .         .         .         .         .         .  g.106188
cacagagcttcaacatgtttgtaggacaaaccttcacagccatcttccgcacatttagct  c.3684+480

         .         .         .         .         .         .  g.106248
atacttgctcttggcaagcatgaccttaacctctactttaaatttttctttaagagctgt  c.3684+540

         .         .         .         .         .         .  g.106308
ctgaaggttgggaaaaattctggttaaacagcctttatttgtcagggttgtatgaagaat  c.3684+600

         .         .         .         .         .         .  g.106368
gctttgattaggtttttattaggggaatgttgagttgtcatttgtattatttttagattg  c.3684+660

         .         .         .         .         .         .  g.106428
ccaacgttagtaattttataaatattcattccaaaatggatttgaagtagatttttaaac  c.3684+720

         .         .         .         .         .         .  g.106488
gtatgtatatagtgtagcaaactacagaatatcagcagaagtccttatcataaaactggc  c.3684+780

         .         .         .         .         .         .  g.106548
tgaacatattttttgtgtgtgcccatacttacaaattgaagagtaagtctaccttacata  c.3684+840

         .         .         .         .         .         .  g.106608
ttcatgtggaatactgttttcattgcatatattagatataatttgatttttgccttaaat  c.3684+900

         .         .         .         .         .         .  g.106668
aggatatgtgtttttgcattcttctataaattatgaacctgagtcttttaaaagtcttat  c.3684+960

         .         .         .         .         .         .  g.106728
aaacaaatactcctcaacttacaatggtgttacatcccgacaaacccatcataaattgaa  c.3684+1020

         .         .         .         .         .         .  g.106788
aatatcaggacatggccccatcttaagtctagtggagtactgaatgtgcatcccttctgc  c.3684+1080

         .         .         .         .         .         .  g.106848
accattataaagtcgaaaaatcctaagtccagccgttgttaagccagagactgtctgtat  c.3684+1140

         .         .         .         .         .         .  g.106908
attttttttttctaaaatgaatctaaatgtgaagtaaagcttgatatttaaaggtatcct  c.3684+1200

         .         .         .         .         .         .  g.106968
gaaatgaacccatttgcaaattgaagagcacttttgtattatgcctcctaatttgtccgt  c.3684+1260

         .         .         .         .         .         .  g.107028
cttatatttttgattagctatccactgagtttcatgaaaatgataaaaaatacatatgca  c.3684+1320

         .         .         .         .         .         .  g.107088
catgcactcactatccacacacatttgaaaaatttttatctcaaattatttatagtttct  c.3684+1380

         .         .         .         .         .         .  g.107148
gattctagaaattgaatatttgatacagatatggagtcaaattgtcaggtgatttttttg  c.3684+1440

         .         .         .         .         .         .  g.107208
ttgtttatacacttggacatttccaaaaaaacaatatggcgaatgatctatcctgtgaca  c.3684+1500

         .         .         .         .         .         .  g.107268
aagcagatatgagcagagctgacactcagccagtcgtctccactacatttttgcttattt  c.3684+1560

         .         .         .         .         .         .  g.107328
gttttgtgtaggccttgtgaaaatagtacctgatctggttgagaatcaaggaagcctgga  c.3684+1620

         .         .         .         .         .         .  g.107388
gttttccagccttcctaagccgcagggagttgctgatctcccctgggcccgagggctgcc  c.3684+1680

         .         .      g.107412
aggtggggcctgacgtgcactccc  c.3684+1704

--------------------- middle of intron ---------------------
                       g.107413         .         .           g.107436
                       c.3685-1704  ctcccagttgtcctgccatcaagg  c.3685-1681

.         .         .         .         .         .           g.107496
ctagctgtgagcagccttgctgaggctcctgtcccttcttggctgccagtgtgtcagaaa  c.3685-1621

.         .         .         .         .         .           g.107556
aatgttgccgttttcaggggggcttgtgtcctgatgtaaagatgtttgaaaacactgaga  c.3685-1561

.         .         .         .         .         .           g.107616
gactgcagtcaaagactctggttctgaaagatcaggacaacataggctggcatcaccatg  c.3685-1501

.         .         .         .         .         .           g.107676
gttgatgcgaccatgaagtgctggggcagagaacccaggaagatgcattgtgcacttcca  c.3685-1441

.         .         .         .         .         .           g.107736
gctatttggttttccatgaaggtcataaacaggcactttacaagagaatcttttcatctt  c.3685-1381

.         .         .         .         .         .           g.107796
gggcatggggttgtctgagcccctcatggtccaggtgatgagagggtaatgtgtggttct  c.3685-1321

.         .         .         .         .         .           g.107856
aggaagaaagtaggcgaagcgggacatctgttcaccagaggagacattaccagatatttt  c.3685-1261

.         .         .         .         .         .           g.107916
gtactgtgaagtctgaacccactcccagctagtctgtgtccttgtcagatgaaatgtaat  c.3685-1201

.         .         .         .         .         .           g.107976
atttagacaaattgactttaatcaatctggaggcaaactagaatagaaggtttttcagaa  c.3685-1141

.         .         .         .         .         .           g.108036
ataattattatcttgaattgtagatttttttactttattggattgcattcatttctaaca  c.3685-1081

.         .         .         .         .         .           g.108096
cttattaagttcctgcagtgcgaaagacgttatcttgggagccgacacagtcatctcatt  c.3685-1021

.         .         .         .         .         .           g.108156
tgagccgctagtacactcatactctttctctaaaacaagttgcctctttttgaatataca  c.3685-961

.         .         .         .         .         .           g.108216
gtttgtgaaattggatgtctgaagttctgtgttttcctctttcttccctcgactgataca  c.3685-901

.         .         .         .         .         .           g.108276
ctgaaattccccgtttgatttctaacaagcccactcagcatatgataaaaataatttggg  c.3685-841

.         .         .         .         .         .           g.108336
aagataaatcctgaagcatatgccgaacttttagaatcattttttaagtgtggaagtcat  c.3685-781

.         .         .         .         .         .           g.108396
cctataacattgctaaaaatcctgagaactgttggtttctgaggaattagcagagagata  c.3685-721

.         .         .         .         .         .           g.108456
atgtacctttgtttgacgtaatataaaatgaaaattttagcccatatgtaattgctttct  c.3685-661

.         .         .         .         .         .           g.108516
ctgcttcatttaaattattttaattaagtataattttgaggttttttttgttactgatac  c.3685-601

.         .         .         .         .         .           g.108576
ctttttagttatcccatccatagctccaatcattaacaataatacccatagaaatatatt  c.3685-541

.         .         .         .         .         .           g.108636
aagcacacttcaaaggctatatatttggcacatatatgtgatttttattgtcttagtgcc  c.3685-481

.         .         .         .         .         .           g.108696
tagtaacaaggtttcacatacttatgtcttttgtaaggatttgaaaataagcatttatat  c.3685-421

.         .         .         .         .         .           g.108756
ttggcataaggtaaatggaattaaaagaattaatgttaggtactttttcatatggatgtc  c.3685-361

.         .         .         .         .         .           g.108816
cttattaaaatcttacatccccatgtgaaatagatgtcatacccatatgaccaatgaggt  c.3685-301

.         .         .         .         .         .           g.108876
cactgaagcgaggagacattaagtaacttgttgtaaaagtaacagaatcaagatacacat  c.3685-241

.         .         .         .         .         .           g.108936
ccaggagaactcatatttcttatagtggaccacagtttcctccctgaacggattttgctc  c.3685-181

.         .         .         .         .         .           g.108996
tgggaagatggttttaatagcttgtaaaatagtaacgtcaaggactaaatccagcaaccc  c.3685-121

.         .         .         .         .         .           g.109056
cttcccttttctttctgccttgagaaatgggacccctctggtctggaggacagatcactt  c.3685-61

.         .         .         .         .         .           g.109116
acttgtttgtaccttgccccagctgtccactggttaaaatcactctgtttttaaccccag  c.3685-1


Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center