SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2) - 464 nt intron 30 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.171395
gtagatattttgtttaccaactttattcttcaagtaaataaaggagcagtgtaaagtcat  c.4359+60

         .         .         .         .         .         .  g.171455
tgaaatggttgtagttggagctgaccgccactgatgggtacccagggctcgcgacaggaa  c.4359+120

         .         .         .         .         .         .  g.171515
aggttgggatgtccttgtgcttttccgtgagtgttacttaatcatgttgagagctcacgt  c.4359+180

         .         .         .         .         .    g.171567
tatattgcattttattgaagagctttcaggctccctgctccccctgcccaca  c.4359+232

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.171619
        ttattgctcttctcatttcccatcatatgctcctccttggcaaaaggaatga  c.4360-181

.         .         .         .         .         .           g.171679
cagtgggagtgggagggtggacttggtgaatggcgccccctggggttatgcagtcccaga  c.4360-121

.         .         .         .         .         .           g.171739
tccctggcagggctttatgctgtgaagacaaagggaaaatcaggctttgttaactaagta  c.4360-61

.         .         .         .         .         .           g.171799
atgatcgctgaattttcctctccctctttttttctccattttctccaaaatttccatcag  c.4360-1


Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center