SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2) - 3853 nt intron 31 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.171961
gtctgtcttgttaagttgtctaaaagttcttaactgtaaatgtgcccgttgttcttttta  c.4461+60

         .         .         .         .         .         .  g.172021
agtagaatatttcattttctacctcttgaatcattgctactggcagaagaaaaataacta  c.4461+120

         .         .         .         .         .         .  g.172081
aaagcctatgttccttgctacctgtgtaagaaaatagaggctttggcatctgcagattac  c.4461+180

         .         .         .         .         .         .  g.172141
ctttgtaccacagctgtgctagcgcctactcacacttcttttcaaagcttatagtctttt  c.4461+240

         .         .         .         .         .         .  g.172201
tttttttttttttttttttttttccttttttgaggcagaatttcactgtctcccaggctg  c.4461+300

         .         .         .         .         .         .  g.172261
gagtgcagtggtgccttctcggctcatggcaacctccgcctcccaggttcaagccattct  c.4461+360

         .         .         .         .         .         .  g.172321
tctgctctcagcctcccaagtacctgggattacaggcacccaccaccatgcctggctgat  c.4461+420

         .         .         .         .         .         .  g.172381
ttttgtatttgtagtacagatggagtttcaccatgttggccaggctggtcttgaactcct  c.4461+480

         .         .         .         .         .         .  g.172441
gacctcaggtgatccgcctgcctcggcctcccaaagtgttgggattacaggcatgagcca  c.4461+540

         .         .         .         .         .         .  g.172501
ccacacccggcctcaaagcatatatttttttttcgagatggagtctcgcccaggctggag  c.4461+600

         .         .         .         .         .         .  g.172561
tgcagtggcatgatctcggctcactgcaacttccacctccctggttcaagggattttcct  c.4461+660

         .         .         .         .         .         .  g.172621
gccttagcctcctgagtagctgggattacaggcatgcgccaccacgccaggcaaattttt  c.4461+720

         .         .         .         .         .         .  g.172681
gtatttttagtagagacggggtttcaccatgttagccaggctggtcttgaactcctgacc  c.4461+780

         .         .         .         .         .         .  g.172741
tcaggtgatctgcccacctcagcctcccaaagtgctgggattacaggtgtgcaccactgt  c.4461+840

         .         .         .         .         .         .  g.172801
gccaggcctcaaagcttatattctaattagaggagggattcaagtaaatcattgaaggta  c.4461+900

         .         .         .         .         .         .  g.172861
atgctgaaaggctggcagtaccatttttgcttttttggagattgtatatttgattacatt  c.4461+960

         .         .         .         .         .         .  g.172921
tacctttatttttctgattgtactcttggatcaggagctgaaactactagaatttaagac  c.4461+1020

         .         .         .         .         .         .  g.172981
aaaacaaactataggaaaaaaagaaacactgcctctaattgctttttaatcctttttatc  c.4461+1080

         .         .         .         .         .         .  g.173041
agcccaattgcaattctctttttactccccttctccacagtcaacaattctaagagtata  c.4461+1140

         .         .         .         .         .         .  g.173101
taaatgaactgaatttattaaaataaccaaggtgagggcactttcattttaattacacct  c.4461+1200

         .         .         .         .         .         .  g.173161
caattactgtcaccttatgtaggacttttttcctgtctgtatctctggcctgatgccttc  c.4461+1260

         .         .         .         .         .         .  g.173221
agacccatgaagaagaaagaaaaagacaaagatgtacccctcaaccaatgcagtgtcaag  c.4461+1320

         .         .         .         .         .         .  g.173281
ccacctttaaattccttaagcctgtttcctgatcatacccttctgcctgcacatcaattt  c.4461+1380

         .         .         .         .         .         .  g.173341
cagtcatcaaacaaaggaatagagaaatcttcagaatgtgccttgaacagacttaaacat  c.4461+1440

         .         .         .         .         .         .  g.173401
ttccaagttaatagtagtagtatcttgaccaaaacaggaggtcttgaaagcaagccttct  c.4461+1500

         .         .         .         .         .         .  g.173461
gttactcaagacactctccaaggaaaaagttaagcttgaagccaggacatagaaagtaga  c.4461+1560

         .         .         .         .         .         .  g.173521
agaatcaacaaagaaggttttgtgaatgacagacagtttgttttagtctctggatagata  c.4461+1620

         .         .         .         .         .         .  g.173581
tttggattctttatgtcaatatggcattattatgatatacatccagtccttttttctaca  c.4461+1680

         .         .         .         .         .         .  g.173641
accttcctatctgttttcactctgactgtctcacaactgaaataaggtgtcaagtggcct  c.4461+1740

         .         .         .         .         .         .  g.173701
cttgactggtttctcccccaggccatctggacactaatttgtctttctctagccaccttc  c.4461+1800

         .         .         .         .         .         .  g.173761
ctatcctgttcatttactgcctctcttcccaacctttgaggttcccctgcactgtctaga  c.4461+1860

         .         .         .         .         .         .  g.173821
atgaatttcatctctgtagactgcttgctgaggtctaaggtaagtctttagcttcatctg  c.4461+1920

         g.173828
ctactcc  c.4461+1927

--------------------- middle of intron ---------------------
                                         g.173829             g.173834
                                         c.4462-1926  tcaacc  c.4462-1921

.         .         .         .         .         .           g.173894
taaacagcccatagtccattcggactgatactatgatcacctgcttccccagttacattt  c.4462-1861

.         .         .         .         .         .           g.173954
cttttactctttaagatcattcgagactcacatgcagttgtaagatacagtacagagaga  c.4462-1801

.         .         .         .         .         .           g.174014
ttctgtgtaccttttacttctcaagatggaaacatcttgcaaaacataggataatatctt  c.4462-1741

.         .         .         .         .         .           g.174074
tttttttttttttttgagatggagtctcactctgttgcccaggctggaatgcagtggtgc  c.4462-1681

.         .         .         .         .         .           g.174134
catctcggctcgctgcaaactctgcctcctgggttcaagcaattcttctgcctcaccctc  c.4462-1621

.         .         .         .         .         .           g.174194
ccaagtagctgggattaaggcatgcaccaccatgcccggctaatttttgtatttttttta  c.4462-1561

.         .         .         .         .         .           g.174254
gtagagatggggtttcaccatgttggccgggctggtctcgaactcctgacctcgtgatct  c.4462-1501

.         .         .         .         .         .           g.174314
acccacctcagcctcctaaagtgctaggattacaggtgtgagtaccacacctggcccaag  c.4462-1441

.         .         .         .         .         .           g.174374
acaatatcttaagcagaaaattgacatcaatacaattcccagatgcatctcttttattct  c.4462-1381

.         .         .         .         .         .           g.174434
tgcctcctcatctttctcatttgttttcctttctaaaaagcccctcatttctcaccgctg  c.4462-1321

.         .         .         .         .         .           g.174494
aaggaattcttctcatctttaagatccagctcaactctgatgtctctggaaaattctgcc  c.4462-1261

.         .         .         .         .         .           g.174554
ctgatggtcccatcctctctctctctcgcgcgggtcctttgttctgtcatactcatactc  c.4462-1201

.         .         .         .         .         .           g.174614
actgcctatattgttcatttggtgcaaactgcaatttgcccagtcacttttttgaacgag  c.4462-1141

.         .         .         .         .         .           g.174674
taggtcttctttacaataaaaggaatatgttcctaaagagcaggggttgttttattttcc  c.4462-1081

.         .         .         .         .         .           g.174734
tttaaatttttaaaacactgtgattaagagacataacaaaatttatcataatttttcagt  c.4462-1021

.         .         .         .         .         .           g.174794
atacagttcagtagtgttaagtatattcactttgatgggcaacagatcttcagaactttt  c.4462-961

.         .         .         .         .         .           g.174854
taatcttgcgactctgaaactgcgtgcctacgaacaactaactctcatctccttccccca  c.4462-901

.         .         .         .         .         .           g.174914
gcccctggcacccaccatggcactttctgtttctatgaatttgcccattttagatacttc  c.4462-841

.         .         .         .         .         .           g.174974
gtatgagtagaatcatagagttacttgtctttttgtgactggcttatgcacttatggact  c.4462-781

.         .         .         .         .         .           g.175034
tagcgtaacaatcctccagttacaggatttccttcctttttaagactgaataatattcca  c.4462-721

.         .         .         .         .         .           g.175094
ttaaatgtatagactatagttgcttatccactcatttgtcgatggacccttgggttgctt  c.4462-661

.         .         .         .         .         .           g.175154
ccacctcttggctattgtgaataatgctgctaggaacatgggtgtgccaatgtcttttca  c.4462-601

.         .         .         .         .         .           g.175214
agacgcctcttgtgattctttatatacccagaagtggggctgctggatcatatagtagtt  c.4462-541

.         .         .         .         .         .           g.175274
ctattttcaattttttgaggaaaaggaccatttttgaacttatatctttcagcacctacc  c.4462-481

.         .         .         .         .         .           g.175334
cagggccatgctcagacatgtgtatccattaaaaatagagtgttgattggataagtgttg  c.4462-421

.         .         .         .         .         .           g.175394
gctgctactgataaactcagtaataaggaatagcccccacttgctaggggcactgcattt  c.4462-361

.         .         .         .         .         .           g.175454
taaagaagattgctttaccacagtcttactacagcatttggtagaacaattcaaataaga  c.4462-301

.         .         .         .         .         .           g.175514
aatgtagttttaaaaaataccatttttgttgtccaatatgaggatattttatctactatt  c.4462-241

.         .         .         .         .         .           g.175574
ctcctccaagcatccatgcactttgaaataatttcaactgcatttggactttctgtatga  c.4462-181

.         .         .         .         .         .           g.175634
atgtgtatgtctgtatttgggcttggcgttttgctactgggttttcatgtgggcataaaa  c.4462-121

.         .         .         .         .         .           g.175694
gctaacggtgacatttctactaaaattcatgtgaattaagctggtgtattgcataaggaa  c.4462-61

.         .         .         .         .         .           g.175754
gagttcactgccatggtaactcagcttgcagttttaacagatgcccctttgaccatttag  c.4462-1


Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center