SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2) - 5037 nt intron 32 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.175947
gtaagcccagacattcgggtcctgtacatctttgcccctcctcacctgcatagctgtctc  c.4594+60

         .         .         .         .         .         .  g.176007
cacagatgttcacagaagagactttagagtggggcagatctggattggagcccttattcc  c.4594+120

         .         .         .         .         .         .  g.176067
actttgtccttgctgggcaaccggtggccatgtccttatccctgctcatgctcagttttc  c.4594+180

         .         .         .         .         .         .  g.176127
tcatctataaaactgaggtcataaaaatgacctccaagcatgtaaaatgtttagcatagg  c.4594+240

         .         .         .         .         .         .  g.176187
ctgggctcctagcaaacactgttttatttcttttatttatttatttttgagacagggtct  c.4594+300

         .         .         .         .         .         .  g.176247
cactctgtcacccaggccggagtgcagtggcatgatcttagctcactgcaacctccacct  c.4594+360

         .         .         .         .         .         .  g.176307
cccagtagctcactgcaacctccacctcccaggttcaagtgattcacctgcctcagcctc  c.4594+420

         .         .         .         .         .         .  g.176367
ccgagtagctggaattacaggcgtgtgccaccacgcccggctaatttttatatttttagt  c.4594+480

         .         .         .         .         .         .  g.176427
agagatggagtgtcaccatgttggcaaggctggtctcaaactcctggcctcacgtgatcc  c.4594+540

         .         .         .         .         .         .  g.176487
acccgcctcggcctcccaaagtgctgggattataggcacaagccgccacacctgacctgc  c.4594+600

         .         .         .         .         .         .  g.176547
aaacactttctgaatgttgcctttgaatattagcctactacacattttctacaacactgc  c.4594+660

         .         .         .         .         .         .  g.176607
tgctaatgccacctatcttctcttctttaccacggtggttctcaaacctggagggcttga  c.4594+720

         .         .         .         .         .         .  g.176667
agaatatgccagtgtttgatccagtagcctgttgtggggcctgagaatccgtatttctgg  c.4594+780

         .         .         .         .         .         .  g.176727
caaattcccagggggaactgatgatgttgggccaaggaccacaccttgagaatcacagct  c.4594+840

         .         .         .         .         .         .  g.176787
ttagaaaataattgtcaaactgagttggaactgtgaattttgcatagaattttttttttg  c.4594+900

         .         .         .         .         .         .  g.176847
ccaggggaagaggggtgatgacagggtactgtctttatttaaaatgttgatagtttgttt  c.4594+960

         .         .         .         .         .         .  g.176907
atcatggatttggggggcattaatttgggtttttaaaatatttaccttttaggatattag  c.4594+1020

         .         .         .         .         .         .  g.176967
ttgatgactgggttttggtgcccccttaaattttacacccaaggtgcgtgcctccattgt  c.4594+1080

         .         .         .         .         .         .  g.177027
ttgaccctagttccagccgtgactgataacccaaatattccaaaggttaagggtgctgtc  c.4594+1140

         .         .         .         .         .         .  g.177087
agaagttgaaaatttcttcttagtgaggcatgttggctcacaaatataatccgagcactc  c.4594+1200

         .         .         .         .         .         .  g.177147
tgggaggctgaggcagaaggatagcttgaggctaggagttcaagaccagcctggataaca  c.4594+1260

         .         .         .         .         .         .  g.177207
tagcaagaccctatctctacaaaaatgtttgtaaaaagaaatagccaagtgtggtggcac  c.4594+1320

         .         .         .         .         .         .  g.177267
gtgtctatagtcccagctactcaggaagctgaggcaggaggattgcttagtctaggtgtt  c.4594+1380

         .         .         .         .         .         .  g.177327
caaggctgcagtgagctatgatcataccgctgccctccagcctgggcaacagaacaaaac  c.4594+1440

         .         .         .         .         .         .  g.177387
tctatctaaaaaaaaaattttaaatataattaataaatattttaaaacataaaatttctt  c.4594+1500

         .         .         .         .         .         .  g.177447
ctttcctatgtgtgtcttcactgtatacctctcaaagtaaagtactaaaacctatgtttt  c.4594+1560

         .         .         .         .         .         .  g.177507
acagtataagccgagcccagtggctcatgcctgtaatcctagcactttgggaagctgagg  c.4594+1620

         .         .         .         .         .         .  g.177567
tggctggatcacttgaagtcaccagtttgagacaagcctgatcaatatattcataataag  c.4594+1680

         .         .         .         .         .         .  g.177627
tacaaaaatcatgccacaaaactgtgtgctatgtttttataaacaaatttatgtgtggaa  c.4594+1740

         .         .         .         .         .         .  g.177687
aaaaaggtaacgtctcaaaatattacatgtatgtagagatatagaattacacgttttttt  c.4594+1800

         .         .         .         .         .         .  g.177747
accttttcaaatatattaaaagtatagacatgcttttaaaaaattattaggtttctaatt  c.4594+1860

         .         .         .         .         .         .  g.177807
acatgttaatacagatgatttggaaaatgtaatgatttttgtacttattatgaacacttt  c.4594+1920

         .         .         .         .         .         .  g.177867
ccatggcaatgagggtttttctacagcaacatatattaatatgtataatacatattaaca  c.4594+1980

         .         .         .         .         .         .  g.177927
ttcattaatgaatgtgaatgtactgtaacgtgttaattatactctgttaatcaggctgtt  c.4594+2040

         .         .         .         .         .         .  g.177987
tcccaataatgctgtcctgagcattttacccatagattattgaaaagatgtaaaatgtat  c.4594+2100

         .         .         .         .         .         .  g.178047
gtgatgtatacacattgccacagagaatggagtttccattcttgccctcaacatacataa  c.4594+2160

         .         .         .         .         .         .  g.178107
gcgactctttcccaacgtcattttctattatctatattctagttagtgattctgcctttt  c.4594+2220

         .         .         .         .         .         .  g.178167
atttgttatgaatttaaactgtcccaaattcatgtagttattcctttgttctagcatttg  c.4594+2280

         .         .         .         .         .         .  g.178227
aatacatctgcatcatctattttagctatatatttcattattttagagccagatttctaa  c.4594+2340

         .         .         .         .         .         .  g.178287
tctgttttcaaagagctgctctcttcccccatccatcaatttagtttaatttctcaagcc  c.4594+2400

         .         .         .         .         .         .  g.178347
ttggtatattaattttctattgctgctataacaaattaccacaaacttagtgactttaat  c.4594+2460

         .         .         .         .         .           g.178406
acaacacaaacttattacctcttgtgggtcacaggttcagcatgagtctccctggacta  c.4594+2519

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.178464
  agatcaatgtgtcagcagcctgcattcctttctggatgctctagataggaatcccatt  c.4595-2461

.         .         .         .         .         .           g.178524
tccttgttcatcctggttctcagcagagttcaatttcttgtgttcgtagaaacaaagttc  c.4595-2401

.         .         .         .         .         .           g.178584
ccactttcttgctggctgccagtggaaggctgttcccaacagtgttctttggctcattgc  c.4595-2341

.         .         .         .         .         .           g.178644
ctccccacccctaccccttgttccaactttaaagccagcaatgacaggtacagtccttct  c.4595-2281

.         .         .         .         .         .           g.178704
catgttgtgtctccatgaatctctcttttgcgtcttcctcttccacgtttaaggatgcag  c.4595-2221

.         .         .         .         .         .           g.178764
atgattagactgggcccacctggataatccactataatttccccatctcagggtcagaca  c.4595-2161

.         .         .         .         .         .           g.178824
attaacagtctaaaattccttttgccatgtaatataacatattcagaggttcttggatta  c.4595-2101

.         .         .         .         .         .           g.178884
ggatatggacatcttgtgaggagatgatattctgtccaccacacttggtagctagaactt  c.4595-2041

.         .         .         .         .         .           g.178944
ttcataggtgcatatggttgtatcataaaaccttaggaagctgtttatagggctcaccta  c.4595-1981

.         .         .         .         .         .           g.179004
atggtccagtttattagcctgcttgtccatagtctgtcaggtgggttttttggagagaca  c.4595-1921

.         .         .         .         .         .           g.179064
tatccactgacgcgtgcctgacagcattagagtgcgccacactccaaggcacatttagat  c.4595-1861

.         .         .         .         .         .           g.179124
tacgctctcaaggatacattttcttacccctattgcctgtcttctgcccattcatttcct  c.4595-1801

.         .         .         .         .         .           g.179184
atactcctgtgtcagggagagcccacacctgtataaatggacatatttcactttgtcttt  c.4595-1741

.         .         .         .         .         .           g.179244
ccacactgtttagaaatgcccattatgactggcttctttcatctatttctttcgacgtcc  c.4595-1681

.         .         .         .         .         .           g.179304
tacatctttccgttttcattagtaggtaggccttttcatctccagtctcttcttcttctc  c.4595-1621

.         .         .         .         .         .           g.179364
ctaagttactccacccaaagcaaagggccccaccttatagcttgtcaagcagcagacagt  c.4595-1561

.         .         .         .         .         .           g.179424
gggtataatagatagaagccttggctaggagtactattttgtgtattaggatttggaatg  c.4595-1501

.         .         .         .         .         .           g.179484
gaggaaaggcaaatgctaccaccacacttgagttcataacagcacagctctcatctcttc  c.4595-1441

.         .         .         .         .         .           g.179544
tgttagcttatgtttctgtgggagattttagttttggaaatattttgtgggtccctctac  c.4595-1381

.         .         .         .         .         .           g.179604
ttcacaaaagaagtctgaaacaaacactctcatctccttctggagctaggattccctcta  c.4595-1321

.         .         .         .         .         .           g.179664
tgacaacatctatttctagatgccttgagacccaccaaacatggtagtctagcaaagcta  c.4595-1261

.         .         .         .         .         .           g.179724
gcttgaatgagagacccacattttcagtgccttcatcatcaaataccaaaaatggtattc  c.4595-1201

.         .         .         .         .         .           g.179784
tgtggatacctatcccaaatagctaccatggagcagattgtctttgttctttgggatatg  c.4595-1141

.         .         .         .         .         .           g.179844
tacctatatttgtgatattgtaccttgaactcttccaagtgtttccattggtatccccag  c.4595-1081

.         .         .         .         .         .           g.179904
aatagtcctgtgaaggtggaaatgggtgcagtctttctgaaggctaatctgacagagcac  c.4595-1021

.         .         .         .         .         .           g.179964
tgttagaaatttaccatatggacatgtccaccatacctccctcaaattctaccaagatac  c.4595-961

.         .         .         .         .         .           g.180024
attgaaataggttcacagcagctttgtttatactagcaaaaaaagcagcaaacttcagcc  c.4595-901

.         .         .         .         .         .           g.180084
ctcatcatatgagactgattaaataaattatagtataccatacgatggaaaattttcagg  c.4595-841

.         .         .         .         .         .           g.180144
tatttaaaagaattaggcaggtatgtatgaggctttacctataaatatcccacatatgtg  c.4595-781

.         .         .         .         .         .           g.180204
agtaaacagccaagtggagaatatggacatgtataaagatccctttgggataactacata  c.4595-721

.         .         .         .         .         .           g.180264
aagaattcaagtatgtacgtgtgtatatatacttacttgaattctttatattctatagag  c.4595-661

.         .         .         .         .         .           g.180324
agacttttatagaatatgtagaatcacacacacacacatacacacagagagagagaaatg  c.4595-601

.         .         .         .         .         .           g.180384
gatgtacttgcaggtatggacataaacattttttttcctggaaataattagttataggga  c.4595-541

.         .         .         .         .         .           g.180444
aagagactaggaatgggggaaaggaagcattcaaaagtgttttctttttactttccattt  c.4595-481

.         .         .         .         .         .           g.180504
tgtacctttatgttaaaaatatgattgaactatttgaattttctttttaagtcaatggag  c.4595-421

.         .         .         .         .         .           g.180564
ttatctacatggtaaaattattggcctttaaactctttacatttatttatatttttaatg  c.4595-361

.         .         .         .         .         .           g.180624
taaaagttctattaaatgattgcccaacacctccacaagtagaaaacacttcccctcatt  c.4595-301

.         .         .         .         .         .           g.180684
atccttggtcagccattgggagacaggtgaaggatccagccccactgtcctccatgagac  c.4595-241

.         .         .         .         .         .           g.180744
ctcggtccctcttgttgcctgtttagcgtgactacatcatttatcttccaaaagaagaca  c.4595-181

.         .         .         .         .         .           g.180804
ggttggcaagtgaaaggggtcgctgactagacagaaccacacagaacaggcataaaccgg  c.4595-121

.         .         .         .         .         .           g.180864
gaatgttctgggcactctgggatgtttgtgttgtctgtaggttggtgatagtcttaccac  c.4595-61

.         .         .         .         .         .           g.180924
ctatacaaagatctccttgtgattactcactggtgtctatttcatttgctttggttttag  c.4595-1


Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center