SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2) - 1295 nt intron 33 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.181127
gtaagtgtagccgactgggactgaaggcggagacgccctctcccctgcttgctggcctct  c.4737+60

         .         .         .         .         .         .  g.181187
tgcatttccatgccccttcagccttttcgctttattacccaggactggaaatgtcaggat  c.4737+120

         .         .         .         .         .         .  g.181247
ttagtgagatttcattattgagggatgtgaacggagctgtatgatttagaacaaaggatt  c.4737+180

         .         .         .         .         .         .  g.181307
gggggctttgtttattgcctttttaatagtcttcaaaaatgaaaaactaccaaatcaagc  c.4737+240

         .         .         .         .         .         .  g.181367
ttccctttccccctttttaatcttcccacatgctttcttataaatatggttttccccgta  c.4737+300

         .         .         .         .         .         .  g.181427
gccagttaatattttacatgcatcacagccagcatggtgcctggtacataacagtagatt  c.4737+360

         .         .         .         .         .         .  g.181487
agatggaagaatgagaaaaactgttatgacgtcagagttattggctcgagttgctactta  c.4737+420

         .         .         .         .         .         .  g.181547
agggaccatgtaaaaactcaaaggactttttaagtacctaggggtgttatttttcatatt  c.4737+480

         .         .         .         .         .         .  g.181607
tgaaaaattcagtgagcatctattgagccaggccttgtaataggtacctccctgtgtggt  c.4737+540

         .         .         .         .         .         .  g.181667
agcatattaaatactgatgtcggcatcgtgagatagatgtcactctcaaataacatgtta  c.4737+600

         .         .         .         .          g.181715
tggaaatggttaggttatgggtgttttgctacagatcacgtcgcagag  c.4737+648

--------------------- middle of intron ---------------------
 g.181716           .         .         .         .           g.181762
 c.4738-647  gtggaattcggacccgagtagcataactcagtctagtgtgctatgtc  c.4738-601

.         .         .         .         .         .           g.181822
tgactgggcagcaaggtagaagagtgggcagaagctcctaataccttgccttttgaaata  c.4738-541

.         .         .         .         .         .           g.181882
cccttcatttcatccattcactttccagaggatggtttcctggcacccacattattttct  c.4738-481

.         .         .         .         .         .           g.181942
ttctggaaagataaatttcccttttcctagtttgattttccttcaacacattaccatttt  c.4738-421

.         .         .         .         .         .           g.182002
ggtaaaatttcagaattatgatctcaccccagccttaacccttgatgcaagcattttcaa  c.4738-361

.         .         .         .         .         .           g.182062
atacatttttctttaggagatgtcaaatgcagggtatttttttttctcccatgaattttc  c.4738-301

.         .         .         .         .         .           g.182122
taaaacctggggctgaaaaagagaaaatattagccataaacctttcaagccaaagtgaaa  c.4738-241

.         .         .         .         .         .           g.182182
gggcacaaacaatagcttagagggtgggctttgctttggggtttttcagtaagaaaaact  c.4738-181

.         .         .         .         .         .           g.182242
tctcagcttagagactgtcgatgcctctttaatgtgtttctgtcctcccacggaaagaga  c.4738-121

.         .         .         .         .         .           g.182302
tttggcgagttgtttccaaaatgtcattttttcctactggcctcttgatggtttgttgtt  c.4738-61

.         .         .         .         .         .           g.182362
atatcttctttttcttgcatgtgatgttacttcattttatcttcttatttttacttttag  c.4738-1


Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center